EMAIL THIS PAGE TO A FRIEND

VSIG10

V-set and immunoglobulin domain containing 10

UniProtKB ID: Q8N0Z9, Q9NWQ7
Gene ID:
Mouse(231668) V-set and immunoglobulin domain containing 10
Rat(304529) V-set and immunoglobulin domain containing 10
domestic guinea pig(100718537) V-set and immunoglobulin domain containing 10
naked mole-rat(101708865) V-set and immunoglobulin domain containing 10
cow(523257) V-set and immunoglobulin domain containing 10
sheep(101107048) V-set and immunoglobulin domain containing 10
Zebrafish(100005564) V-set and immunoglobulin domain containing 10
chicken(416991) V-set and immunoglobulin domain containing 10
dog(486292) V-set and immunoglobulin domain containing 10
Horse(100054850) V-set and immunoglobulin domain containing 10
domestic cat(101100599) V-set and immunoglobulin domain containing 10
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075411 MISSION® esiRNA esiRNA human AC131238.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019086 Rosetta Predictions human pricing
XM_001080115 Rosetta Predictions rat pricing
XM_222215 Rosetta Predictions rat pricing
NM_001033311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155389 predicted 837
2 SASI_Hs01_00155390 predicted 424
3 SASI_Hs01_00155391 predicted 1341
4 SASI_Hs01_00155393 predicted 874
5 SASI_Hs01_00155394 predicted 806
6 SASI_Hs01_00155395 predicted 893
7 SASI_Hs01_00155396 predicted 984
8 SASI_Hs01_00155397 predicted 964
9 SASI_Hs01_00155398 predicted 354
10 SASI_Hs02_00352685 predicted 1388
11 SASI_Hs01_00155392 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366678 predicted 1276
2 SASI_Rn02_00366679 predicted 1490
3 SASI_Rn02_00366680 predicted 1555
4 SASI_Rn02_00366681 predicted 1630
5 SASI_Rn02_00366682 predicted 1102
6 SASI_Rn02_00366683 predicted 1180
7 SASI_Rn02_00366684 predicted 954
8 SASI_Rn02_00366685 predicted 628
9 SASI_Rn02_00366686 predicted 418
10 SASI_Rn02_00366687 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380655 predicted 1912
2 SASI_Rn02_00380656 predicted 397
3 SASI_Rn02_00380657 predicted 1695
4 SASI_Rn02_00380658 predicted 1988
5 SASI_Rn02_00380659 predicted 402
6 SASI_Rn02_00380660 predicted 1377
7 SASI_Rn02_00380661 predicted 1056
8 SASI_Rn02_00380662 predicted 844
9 SASI_Rn02_00380663 predicted 2046
10 SASI_Rn02_00380664 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153219 predicted 313
2 SASI_Mm02_00288510 predicted 1855
3 SASI_Mm02_00288511 predicted 2277
4 SASI_Mm01_00153222 predicted 1037
5 SASI_Mm02_00288512 predicted 2211
6 SASI_Mm01_00153227 predicted 762
7 SASI_Mm02_00288513 predicted 2342
8 SASI_Mm02_00288514 predicted 1082
9 SASI_Mm02_00288515 predicted 1112
10 SASI_Mm02_00288516 predicted 1323
11 SASI_Mm01_00153220 predicted 1459
12 SASI_Mm01_00153221 predicted 1202
13 SASI_Mm01_00153223 predicted 1249
14 SASI_Mm01_00153224 predicted 1241
15 SASI_Mm01_00153225 predicted 1097
16 SASI_Mm01_00153226 predicted 1229
17 SASI_Mm01_00153228 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019086
VALIDATED
VSIG10 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-896s1c1
Sequence:CCGGGCTCAGCAAGAGACATCGAAACTCGAGTTTCGATGTCTCTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-1590s1c1
Sequence:CCGGCCTGTGTTCTGCTGGAAAGTACTCGAGTACTTTCCAGCAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019086.2-1791s1c1
Sequence:CCGGGCCTTGGTGAATGGGAACATACTCGAGTATGTTCCCATTCACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-863s1c1
Sequence:CCGGCCAAGGGAACTACACCTGTTTCTCGAGAAACAGGTGTAGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-596s1c1
Sequence:CCGGCCTGAATGTGACTCAGTGGTTCTCGAGAACCACTGAGTCACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-869s21c1
Sequence:CCGGCACAACCTGACAGTCAACTTTCTCGAGAAAGTTGACTGTCAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019086.5-2110s21c1
Sequence:CCGGACATCTTTCCTTCCATGTATTCTCGAGAATACATGGAAGGAAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-1033s21c1
Sequence:CCGGGATGGCATCAGGATCGTTCATCTCGAGATGAACGATCCTGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019086
VALIDATED
VSIG10 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-896s1c1
Sequence:CCGGGCTCAGCAAGAGACATCGAAACTCGAGTTTCGATGTCTCTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-1590s1c1
Sequence:CCGGCCTGTGTTCTGCTGGAAAGTACTCGAGTACTTTCCAGCAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019086.2-1791s1c1
Sequence:CCGGGCCTTGGTGAATGGGAACATACTCGAGTATGTTCCCATTCACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-863s1c1
Sequence:CCGGCCAAGGGAACTACACCTGTTTCTCGAGAAACAGGTGTAGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-596s1c1
Sequence:CCGGCCTGAATGTGACTCAGTGGTTCTCGAGAACCACTGAGTCACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-869s21c1
Sequence:CCGGCACAACCTGACAGTCAACTTTCTCGAGAAAGTTGACTGTCAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019086.5-2110s21c1
Sequence:CCGGACATCTTTCCTTCCATGTATTCTCGAGAATACATGGAAGGAAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-1033s21c1
Sequence:CCGGGATGGCATCAGGATCGTTCATCTCGAGATGAACGATCCTGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019086
VALIDATED
VSIG10 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-896s1c1
Sequence:CCGGGCTCAGCAAGAGACATCGAAACTCGAGTTTCGATGTCTCTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-1590s1c1
Sequence:CCGGCCTGTGTTCTGCTGGAAAGTACTCGAGTACTTTCCAGCAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019086.2-1791s1c1
Sequence:CCGGGCCTTGGTGAATGGGAACATACTCGAGTATGTTCCCATTCACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-863s1c1
Sequence:CCGGCCAAGGGAACTACACCTGTTTCTCGAGAAACAGGTGTAGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019086.2-596s1c1
Sequence:CCGGCCTGAATGTGACTCAGTGGTTCTCGAGAACCACTGAGTCACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-869s21c1
Sequence:CCGGCACAACCTGACAGTCAACTTTCTCGAGAAAGTTGACTGTCAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019086.5-2110s21c1
Sequence:CCGGACATCTTTCCTTCCATGTATTCTCGAGAATACATGGAAGGAAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019086.5-1033s21c1
Sequence:CCGGGATGGCATCAGGATCGTTCATCTCGAGATGAACGATCCTGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033311
VALIDATED
VSIG10 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033311.3-2213s21c1
Sequence:CCGGAGCTTACCCAACACGAATATGCTCGAGCATATTCGTGTTGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1079s21c1
Sequence:CCGGTGGAGGGCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-305s21c1
Sequence:CCGGCTGGCATACATCCAGACTTAGCTCGAGCTAAGTCTGGATGTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1512s21c1
Sequence:CCGGTTCAGGCCTCACTCTGTATTACTCGAGTAATACAGAGTGAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033311.3-1712s21c1
Sequence:CCGGTAAGCAAGCATGGACACATTCCTCGAGGAATGTGTCCATGCTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033311
VALIDATED
VSIG10 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033311.3-2213s21c1
Sequence:CCGGAGCTTACCCAACACGAATATGCTCGAGCATATTCGTGTTGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1079s21c1
Sequence:CCGGTGGAGGGCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-305s21c1
Sequence:CCGGCTGGCATACATCCAGACTTAGCTCGAGCTAAGTCTGGATGTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1512s21c1
Sequence:CCGGTTCAGGCCTCACTCTGTATTACTCGAGTAATACAGAGTGAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033311.3-1712s21c1
Sequence:CCGGTAAGCAAGCATGGACACATTCCTCGAGGAATGTGTCCATGCTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033311
VALIDATED
VSIG10 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033311.3-2213s21c1
Sequence:CCGGAGCTTACCCAACACGAATATGCTCGAGCATATTCGTGTTGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1079s21c1
Sequence:CCGGTGGAGGGCAAGAAGTTCAAATCTCGAGATTTGAACTTCTTGCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-305s21c1
Sequence:CCGGCTGGCATACATCCAGACTTAGCTCGAGCTAAGTCTGGATGTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033311.3-1512s21c1
Sequence:CCGGTTCAGGCCTCACTCTGTATTACTCGAGTAATACAGAGTGAGGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033311.3-1712s21c1
Sequence:CCGGTAAGCAAGCATGGACACATTCCTCGAGGAATGTGTCCATGCTTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks