EMAIL THIS PAGE TO A FRIEND

VSIG10L

V-set and immunoglobulin domain containing 10 like

UniProtKB ID: Q86VR7
Gene ID:
Mouse(75690) ZV-set and immunoglobulin domain containing 10 like
Rat(308556) V-set and immunoglobulin domain containing 10 like
domestic cat(101095213) V-set and immunoglobulin domain containing 10 like
dog(100686937) V-set and immunoglobulin domain containing 10 like
cow(786345) V-set and immunoglobulin domain containing 10 like
sheep(101122129) V-set and immunoglobulin domain containing 10 like
naked mole-rat(101702302) V-set and immunoglobulin domain containing 10 like
domestic guinea pig(100714008) V-set and immunoglobulin domain containing 10 like
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163922 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718903 Rosetta Predictions human pricing
XM_085831 Rosetta Predictions human pricing
XM_937000 Rosetta Predictions human pricing
XM_001080344 Rosetta Predictions rat pricing
XM_218633 Rosetta Predictions rat pricing
XM_355890 Rosetta Predictions mouse pricing
XM_914186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427029 predicted 1899
2 SASI_Hs02_00427030 predicted 749
3 SASI_Hs02_00427031 predicted 1922
4 SASI_Hs02_00427032 predicted 1241
5 SASI_Hs02_00427033 predicted 1902
6 SASI_Hs02_00427034 predicted 2613
7 SASI_Hs02_00427035 predicted 1240
8 SASI_Hs02_00427036 predicted 2235
9 SASI_Hs02_00427037 predicted 390
10 SASI_Hs02_00427038 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248530 predicted 1882
2 SASI_Hs01_00248531 predicted 869
3 SASI_Hs01_00248532 predicted 1896
4 SASI_Hs01_00248533 predicted 1994
5 SASI_Hs01_00248534 predicted 747
6 SASI_Hs01_00248536 predicted 388
7 SASI_Hs01_00248537 predicted 2606
8 SASI_Hs01_00248538 predicted 444
9 SASI_Hs01_00248539 predicted 1033
10 SASI_Hs02_00478803 predicted 1984
11 SASI_Hs01_00248535 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482380 predicted 1895
2 SASI_Hs02_00482381 predicted 747
3 SASI_Hs02_00482382 predicted 1924
4 SASI_Hs02_00482383 predicted 1241
5 SASI_Hs02_00482384 predicted 1894
6 SASI_Hs02_00482385 predicted 2615
7 SASI_Hs02_00482386 predicted 1240
8 SASI_Hs02_00482387 predicted 2233
9 SASI_Hs02_00482388 predicted 392
10 SASI_Hs02_00482389 predicted 2399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367662 predicted 1028
2 SASI_Rn02_00367663 predicted 865
3 SASI_Rn02_00367664 predicted 373
4 SASI_Rn02_00367665 predicted 249
5 SASI_Rn02_00367666 predicted 752
6 SASI_Rn02_00367667 predicted 2123
7 SASI_Rn02_00367668 predicted 345
8 SASI_Rn02_00367669 predicted 2216
9 SASI_Rn02_00367670 predicted 2403
10 SASI_Rn02_00367671 predicted 1978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377893 predicted 2369
2 SASI_Rn02_00377894 predicted 1024
3 SASI_Rn02_00377895 predicted 858
4 SASI_Rn02_00377896 predicted 370
5 SASI_Rn02_00377897 predicted 255
6 SASI_Rn02_00377898 predicted 752
7 SASI_Rn02_00377899 predicted 347
8 SASI_Rn02_00377900 predicted 2401
9 SASI_Rn02_00377901 predicted 2272
10 SASI_Rn02_00377902 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425875 predicted 1972
2 SASI_Mm02_00425876 predicted 2200
3 SASI_Mm01_00256106 predicted 514
4 SASI_Mm02_00425877 predicted 669
5 SASI_Mm01_00256109 predicted 2445
6 SASI_Mm02_00425878 predicted 395
7 SASI_Mm02_00425879 predicted 2512
8 SASI_Mm01_00256113 predicted 2302
9 SASI_Mm02_00425880 predicted 2369
10 SASI_Mm02_00425881 predicted 386
11 SASI_Mm01_00256104 predicted 2355
12 SASI_Mm01_00256105 predicted 332
13 SASI_Mm01_00256107 predicted 249
14 SASI_Mm01_00256108 predicted 2889
15 SASI_Mm01_00256110 predicted 291
16 SASI_Mm01_00256111 predicted 707
17 SASI_Mm01_00256112 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438382 predicted 1975
2 SASI_Mm02_00438383 predicted 677
3 SASI_Mm02_00438384 predicted 1715
4 SASI_Mm02_00438385 predicted 1773
5 SASI_Mm02_00438386 predicted 1758
6 SASI_Mm02_00438387 predicted 1719
7 SASI_Mm02_00438388 predicted 1920
8 SASI_Mm02_00438389 predicted 670
9 SASI_Mm02_00438390 predicted 2569
10 SASI_Mm02_00438391 predicted 2446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163922
VSIG10L MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 10 like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-269s21c1
Sequence:CCGGCTGGGTCCTTCTGGTCAAATGCTCGAGCATTTGACCAGAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-396s21c1
Sequence:CCGGCAAGCCTTCCTTCACTGTTAACTCGAGTTAACAGTGAAGGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-347s21c1
Sequence:CCGGCTGAAGTATTTCCTGATATTTCTCGAGAAATATCAGGAAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-492s21c1
Sequence:CCGGCCCGGATGATATGGATCTTAACTCGAGTTAAGATCCATATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163922.1-2834s21c1
Sequence:CCGGGGAAACTCTTGCTGATCTAACCTCGAGGTTAGATCAGCAAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163922
VSIG10L MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 10 like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-269s21c1
Sequence:CCGGCTGGGTCCTTCTGGTCAAATGCTCGAGCATTTGACCAGAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-396s21c1
Sequence:CCGGCAAGCCTTCCTTCACTGTTAACTCGAGTTAACAGTGAAGGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-347s21c1
Sequence:CCGGCTGAAGTATTTCCTGATATTTCTCGAGAAATATCAGGAAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-492s21c1
Sequence:CCGGCCCGGATGATATGGATCTTAACTCGAGTTAAGATCCATATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163922.1-2834s21c1
Sequence:CCGGGGAAACTCTTGCTGATCTAACCTCGAGGTTAGATCAGCAAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163922
VSIG10L MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 10 like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-269s21c1
Sequence:CCGGCTGGGTCCTTCTGGTCAAATGCTCGAGCATTTGACCAGAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-396s21c1
Sequence:CCGGCAAGCCTTCCTTCACTGTTAACTCGAGTTAACAGTGAAGGAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-347s21c1
Sequence:CCGGCTGAAGTATTTCCTGATATTTCTCGAGAAATATCAGGAAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163922.1-492s21c1
Sequence:CCGGCCCGGATGATATGGATCTTAACTCGAGTTAAGATCCATATCATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163922.1-2834s21c1
Sequence:CCGGGGAAACTCTTGCTGATCTAACCTCGAGGTTAGATCAGCAAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks