EMAIL THIS PAGE TO A FRIEND

VSIG1

V-set and immunoglobulin domain containing 1

Synonyms: 1700062D20Rik GPA34 dJ889N15.1
UniProtKB ID: Q86XK7, C9J4P2, Q6MZS4
Gene ID:
Human(340547) Summary: This gene encodes a member of the junctional adhesion molecule (JAM) family. The encoded protein contains multiple glycosylation sites at the N-terminal region, and multiple phosphorylation sites and glutamic acid/proline (EP) repeats at the C-terminal region. The gene is expressed in normal stomach and testis, as well as in gastric, esophageal and ovarian cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(78789) V-set and immunoglobulin domain containing 1
Rat(315920) V-set and immunoglobulin domain containing 1
chicken(414795) V-set and immunoglobulin domain containing 1
dog(481013) V-set and immunoglobulin domain containing 1
domestic cat(101089246) V-set and immunoglobulin domain containing 1
cow(505937) V-set and immunoglobulin domain containing 1
sheep(101113914) V-set and immunoglobulin domain containing 1
naked mole-rat(101721559) V-set and immunoglobulin domain containing 1
domestic guinea pig(100718481) V-set and immunoglobulin domain containing 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182607 Rosetta Predictions human pricing
NM_001037784 Rosetta Predictions rat pricing
NM_030181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169263 predicted 1356
2 SASI_Hs01_00169264 predicted 494
3 SASI_Hs01_00169265 predicted 660
4 SASI_Hs01_00169266 predicted 807
5 SASI_Hs01_00169267 predicted 267
6 SASI_Hs01_00169269 predicted 1333
7 SASI_Hs01_00169270 predicted 441
8 SASI_Hs01_00169271 predicted 471
9 SASI_Hs01_00169272 predicted 747
10 SASI_Hs02_00370745 predicted 1049
11 SASI_Hs01_00169268 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058068 predicted 335
2 SASI_Rn01_00058069 predicted 797
3 SASI_Rn01_00058070 predicted 389
4 SASI_Rn01_00058071 predicted 357
5 SASI_Rn01_00058072 predicted 350
6 SASI_Rn01_00058073 predicted 388
7 SASI_Rn02_00204594 predicted 605
8 SASI_Rn01_00058074 predicted 657
9 SASI_Rn01_00058075 predicted 427
10 SASI_Rn01_00058076 predicted 242
11 SASI_Rn01_00058077 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068315 predicted 299
2 SASI_Mm01_00068316 predicted 790
3 SASI_Mm01_00068317 predicted 310
4 SASI_Mm01_00068318 predicted 344
5 SASI_Mm02_00336602 predicted 565
6 SASI_Mm01_00068320 predicted 273
7 SASI_Mm01_00068321 predicted 565
8 SASI_Mm01_00068322 predicted 214
9 SASI_Mm01_00068323 predicted 692
10 SASI_Mm01_00068324 predicted 249
11 SASI_Mm01_00068319 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182607
VSIG1 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182607.4-256s21c1
Sequence:CCGGACGTGACTGTTGGATCTAATGCTCGAGCATTAGATCCAACAGTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182607.4-1538s21c1
Sequence:CCGGTTTACTAACACGTAAGCATAACTCGAGTTATGCTTACGTGTTAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-755s1c1
Sequence:CCGGCCATCAACAGACTTGGCAATACTCGAGTATTGCCAAGTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-395s1c1
Sequence:CCGGCCAACGATCCAGGTAATGCATCTCGAGATGCATTACCTGGATCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-779s1c1
Sequence:CCGGCCTGCGAAATCGATCTCACTTCTCGAGAAGTGAGATCGATTTCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-554s1c1
Sequence:CCGGGCGTTCAAGGAAGACCAGAAACTCGAGTTTCTGGTCTTCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-874s1c1
Sequence:CCGGGTTGTGTGCTTCGCAAGGAATCTCGAGATTCCTTGCGAAGCACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182607
VSIG1 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182607.4-256s21c1
Sequence:CCGGACGTGACTGTTGGATCTAATGCTCGAGCATTAGATCCAACAGTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182607.4-1538s21c1
Sequence:CCGGTTTACTAACACGTAAGCATAACTCGAGTTATGCTTACGTGTTAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-755s1c1
Sequence:CCGGCCATCAACAGACTTGGCAATACTCGAGTATTGCCAAGTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-395s1c1
Sequence:CCGGCCAACGATCCAGGTAATGCATCTCGAGATGCATTACCTGGATCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-779s1c1
Sequence:CCGGCCTGCGAAATCGATCTCACTTCTCGAGAAGTGAGATCGATTTCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-554s1c1
Sequence:CCGGGCGTTCAAGGAAGACCAGAAACTCGAGTTTCTGGTCTTCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-874s1c1
Sequence:CCGGGTTGTGTGCTTCGCAAGGAATCTCGAGATTCCTTGCGAAGCACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182607
VSIG1 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182607.4-256s21c1
Sequence:CCGGACGTGACTGTTGGATCTAATGCTCGAGCATTAGATCCAACAGTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182607.4-1538s21c1
Sequence:CCGGTTTACTAACACGTAAGCATAACTCGAGTTATGCTTACGTGTTAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-755s1c1
Sequence:CCGGCCATCAACAGACTTGGCAATACTCGAGTATTGCCAAGTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-395s1c1
Sequence:CCGGCCAACGATCCAGGTAATGCATCTCGAGATGCATTACCTGGATCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-779s1c1
Sequence:CCGGCCTGCGAAATCGATCTCACTTCTCGAGAAGTGAGATCGATTTCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-554s1c1
Sequence:CCGGGCGTTCAAGGAAGACCAGAAACTCGAGTTTCTGGTCTTCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182607.2-874s1c1
Sequence:CCGGGTTGTGTGCTTCGCAAGGAATCTCGAGATTCCTTGCGAAGCACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030181
VSIG1 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030181.1-1861s1c1
Sequence:CCGGGCAACATTTGAGCATAGCATTCTCGAGAATGCTATGCTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-314s1c1
Sequence:CCGGGCAATTCAAAGACCGAATAATCTCGAGATTATTCGGTCTTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-700s1c1
Sequence:CCGGCCATCAACAGTCTTGGCAATACTCGAGTATTGCCAAGACTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-913s1c1
Sequence:CCGGCCCAACAAAGTGAGGCAATTTCTCGAGAAATTGCCTCACTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-221s1c1
Sequence:CCGGGCTTTCAATTCAATGGTCTTTCTCGAGAAAGACCATTGAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030181
VSIG1 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030181.1-1861s1c1
Sequence:CCGGGCAACATTTGAGCATAGCATTCTCGAGAATGCTATGCTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-314s1c1
Sequence:CCGGGCAATTCAAAGACCGAATAATCTCGAGATTATTCGGTCTTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-700s1c1
Sequence:CCGGCCATCAACAGTCTTGGCAATACTCGAGTATTGCCAAGACTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-913s1c1
Sequence:CCGGCCCAACAAAGTGAGGCAATTTCTCGAGAAATTGCCTCACTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-221s1c1
Sequence:CCGGGCTTTCAATTCAATGGTCTTTCTCGAGAAAGACCATTGAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030181
VSIG1 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030181.1-1861s1c1
Sequence:CCGGGCAACATTTGAGCATAGCATTCTCGAGAATGCTATGCTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-314s1c1
Sequence:CCGGGCAATTCAAAGACCGAATAATCTCGAGATTATTCGGTCTTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-700s1c1
Sequence:CCGGCCATCAACAGTCTTGGCAATACTCGAGTATTGCCAAGACTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-913s1c1
Sequence:CCGGCCCAACAAAGTGAGGCAATTTCTCGAGAAATTGCCTCACTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030181.1-221s1c1
Sequence:CCGGGCTTTCAATTCAATGGTCTTTCTCGAGAAAGACCATTGAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks