EMAIL THIS PAGE TO A FRIEND

VSIG2

V-set and immunoglobulin domain containing 2

Synonyms: 2210413P10Rik CTH CTXL
UniProtKB ID: Q96IQ7, O95791, Q9NX42
Gene ID:
Mouse(57276) V-set and immunoglobulin domain containing 2
Rat(300520) V-set and immunoglobulin domain containing 2
domestic guinea pig(100722362) V-set and immunoglobulin domain containing 2
naked mole-rat(101720579) V-set and immunoglobulin domain containing 2
cow(616943) V-set and immunoglobulin domain containing 2
sheep(101108174) V-set and immunoglobulin domain containing 2
dog(489310) V-set and immunoglobulin domain containing 2
domestic cat(101081077) V-set and immunoglobulin domain containing 2
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014312 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156171 MISSION® esiRNA esiRNA human VSIG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014312 Rosetta Predictions human pricing
NM_001106812 Rosetta Predictions rat pricing
NM_020518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143450 predicted 586
2 SASI_Hs01_00143451 predicted 510
3 SASI_Hs02_00345403 predicted 581
4 SASI_Hs01_00143452 predicted 846
5 SASI_Hs01_00143453 predicted 450
6 SASI_Hs01_00143454 predicted 662
7 SASI_Hs01_00143455 predicted 290
8 SASI_Hs01_00143456 predicted 309
9 SASI_Hs02_00345404 predicted 423
10 SASI_Hs01_00143457 predicted 267
11 SASI_Hs01_00143458 predicted 703
12 SASI_Hs01_00143459 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222648 predicted 475
2 SASI_Rn02_00222649 predicted 902
3 SASI_Rn02_00222650 predicted 655
4 SASI_Rn02_00222651 predicted 370
5 SASI_Rn02_00222652 predicted 474
6 SASI_Rn02_00222653 predicted 218
7 SASI_Rn02_00222654 predicted 609
8 SASI_Rn02_00222655 predicted 283
9 SASI_Rn02_00222656 predicted 506
10 SASI_Rn02_00222657 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325575 predicted 637
2 SASI_Mm01_00056997 predicted 471
3 SASI_Mm01_00056998 predicted 366
4 SASI_Mm01_00057000 predicted 471
5 SASI_Mm02_00325576 predicted 272
6 SASI_Mm02_00325577 predicted 901
7 SASI_Mm01_00057003 predicted 493
8 SASI_Mm02_00325578 predicted 581
9 SASI_Mm01_00057006 predicted 838
10 SASI_Mm02_00325579 predicted 655
11 SASI_Mm01_00056999 predicted 464
12 SASI_Mm01_00057001 predicted 356
13 SASI_Mm01_00057002 predicted 251
14 SASI_Mm01_00057004 predicted 542
15 SASI_Mm01_00057005 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020518
VSIG2 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-368s21c1
Sequence:CCGGTGTATCCCACTGGCTCTAAAGCTCGAGCTTTAGAGCCAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-221s21c1
Sequence:CCGGTGAGCGTGCCAAAGGGTAAGACTCGAGTCTTACCCTTTGGCACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-716s21c1
Sequence:CCGGTGTCCGGCCAGCTCATTCTTACTCGAGTAAGAATGAGCTGGCCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-378s1c1
Sequence:CCGGCCCACCAGATTTCTACACCAACTCGAGTTGGTGTAGAAATCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-724s1c1
Sequence:CCGGCGAGTAGCTGGGACTCTTATTCTCGAGAATAAGAGTCCCAGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-357s1c1
Sequence:CCGGCTACCTCTGCAATGTTAACAACTCGAGTTGTTAACATTGCAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-220s1c1
Sequence:CCGGCCCGTTCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-571s1c1
Sequence:CCGGCCTGGTAGCATGGTTCAAGATCTCGAGATCTTGAACCATGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020518
VSIG2 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-368s21c1
Sequence:CCGGTGTATCCCACTGGCTCTAAAGCTCGAGCTTTAGAGCCAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-221s21c1
Sequence:CCGGTGAGCGTGCCAAAGGGTAAGACTCGAGTCTTACCCTTTGGCACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-716s21c1
Sequence:CCGGTGTCCGGCCAGCTCATTCTTACTCGAGTAAGAATGAGCTGGCCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-378s1c1
Sequence:CCGGCCCACCAGATTTCTACACCAACTCGAGTTGGTGTAGAAATCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-724s1c1
Sequence:CCGGCGAGTAGCTGGGACTCTTATTCTCGAGAATAAGAGTCCCAGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-357s1c1
Sequence:CCGGCTACCTCTGCAATGTTAACAACTCGAGTTGTTAACATTGCAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-220s1c1
Sequence:CCGGCCCGTTCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-571s1c1
Sequence:CCGGCCTGGTAGCATGGTTCAAGATCTCGAGATCTTGAACCATGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020518
VSIG2 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-368s21c1
Sequence:CCGGTGTATCCCACTGGCTCTAAAGCTCGAGCTTTAGAGCCAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-221s21c1
Sequence:CCGGTGAGCGTGCCAAAGGGTAAGACTCGAGTCTTACCCTTTGGCACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020518.2-716s21c1
Sequence:CCGGTGTCCGGCCAGCTCATTCTTACTCGAGTAAGAATGAGCTGGCCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-378s1c1
Sequence:CCGGCCCACCAGATTTCTACACCAACTCGAGTTGGTGTAGAAATCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-724s1c1
Sequence:CCGGCGAGTAGCTGGGACTCTTATTCTCGAGAATAAGAGTCCCAGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-357s1c1
Sequence:CCGGCTACCTCTGCAATGTTAACAACTCGAGTTGTTAACATTGCAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-220s1c1
Sequence:CCGGCCCGTTCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020518.1-571s1c1
Sequence:CCGGCCTGGTAGCATGGTTCAAGATCTCGAGATCTTGAACCATGCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014312
VSIG2 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-304s1c1
Sequence:CCGGCTTCACCAATGGCCATCTGTACTCGAGTACAGATGGCCATTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-452s1c1
Sequence:CCGGCCACCAGATTTCTACACCAATCTCGAGATTGGTGTAGAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-481s1c1
Sequence:CCGGGCTAATCAACCTTACTGTGCTCTCGAGAGCACAGTAAGGTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-293s1c1
Sequence:CCGGCCAATCCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-440s1c1
Sequence:CCGGCAAGTCAACAACCCACCAGATCTCGAGATCTGGTGGGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-315s1c1
Sequence:CCGGGCCATCTGTATCCAACTGGTTCTCGAGAACCAGTTGGATACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-415s1c1
Sequence:CCGGCTCAGATACTGGAACCTACCTCTCGAGAGGTAGGTTCCAGTATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014312
VSIG2 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-304s1c1
Sequence:CCGGCTTCACCAATGGCCATCTGTACTCGAGTACAGATGGCCATTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-452s1c1
Sequence:CCGGCCACCAGATTTCTACACCAATCTCGAGATTGGTGTAGAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-481s1c1
Sequence:CCGGGCTAATCAACCTTACTGTGCTCTCGAGAGCACAGTAAGGTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-293s1c1
Sequence:CCGGCCAATCCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-440s1c1
Sequence:CCGGCAAGTCAACAACCCACCAGATCTCGAGATCTGGTGGGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-315s1c1
Sequence:CCGGGCCATCTGTATCCAACTGGTTCTCGAGAACCAGTTGGATACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-415s1c1
Sequence:CCGGCTCAGATACTGGAACCTACCTCTCGAGAGGTAGGTTCCAGTATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014312
VSIG2 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-304s1c1
Sequence:CCGGCTTCACCAATGGCCATCTGTACTCGAGTACAGATGGCCATTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-452s1c1
Sequence:CCGGCCACCAGATTTCTACACCAATCTCGAGATTGGTGTAGAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-481s1c1
Sequence:CCGGGCTAATCAACCTTACTGTGCTCTCGAGAGCACAGTAAGGTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-293s1c1
Sequence:CCGGCCAATCCTGTACTTCACCAATCTCGAGATTGGTGAAGTACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-440s1c1
Sequence:CCGGCAAGTCAACAACCCACCAGATCTCGAGATCTGGTGGGTTGTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-315s1c1
Sequence:CCGGGCCATCTGTATCCAACTGGTTCTCGAGAACCAGTTGGATACAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014312.3-415s1c1
Sequence:CCGGCTCAGATACTGGAACCTACCTCTCGAGAGGTAGGTTCCAGTATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks