EMAIL THIS PAGE TO A FRIEND

VSIG4

V-set and immunoglobulin domain containing 4

Synonyms: CRIg Z39IG
UniProtKB ID: Q9Y279, Q6UXI4
Gene ID:
Human(11326) Summary: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(278180) V-set and immunoglobulin domain containing 4
Rat(312102) V-set and immunoglobulin domain containing 4
chicken(422170) V-set and immunoglobulin domain containing 4
dog(491925) V-set and immunoglobulin domain containing 4
domestic cat(101081119) V-set and immunoglobulin domain containing 4
Horse(100065734) V-set and immunoglobulin domain containing 4
cow(614262) V-set and immunoglobulin domain containing 4
sheep(101113203) V-set and immunoglobulin domain containing 4
domestic guinea pig(100736078) V-set and immunoglobulin domain containing 4
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41591 Anti-VSIG4 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, horse, human, mouse, rat, rabbit
western blot pricing
HPA003903 Anti-VSIG4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1776 Human VSIG4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029951 MISSION® esiRNA esiRNA human VSIG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100431 Rosetta Predictions human pricing
NM_007268 Rosetta Predictions human pricing
NM_001025004 Rosetta Predictions rat pricing
NM_177789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322144 predicted 1314
2 SASI_Hs02_00322145 predicted 906
3 SASI_Hs02_00322146 predicted 1060
4 SASI_Hs02_00322147 predicted 1266
5 SASI_Hs02_00322148 predicted 227
6 SASI_Hs02_00322149 predicted 1298
7 SASI_Hs02_00322150 predicted 1200
8 SASI_Hs02_00322151 predicted 1173
9 SASI_Hs02_00322152 predicted 838
10 SASI_Hs02_00322153 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343304 predicted 1604
2 SASI_Hs02_00343305 predicted 1188
3 SASI_Hs02_00343306 predicted 1343
4 SASI_Hs02_00343307 predicted 1550
5 SASI_Hs02_00343308 predicted 226
6 SASI_Hs02_00343309 predicted 1575
7 SASI_Hs02_00343310 predicted 1481
8 SASI_Hs02_00343311 predicted 1451
9 SASI_Hs02_00343312 predicted 1123
10 SASI_Hs02_00343313 predicted 1475
11 SASI_Hs01_00120442 predicted 372
12 SASI_Hs01_00120443 predicted 1196
13 SASI_Hs01_00120444 predicted 587
14 SASI_Hs01_00120445 predicted 624
15 SASI_Hs01_00120446 predicted 481
16 SASI_Hs01_00120447 predicted 328
17 SASI_Hs01_00120448 predicted 521
18 SASI_Hs01_00120449 predicted 732
19 SASI_Hs01_00120450 predicted 637
20 SASI_Hs01_00120451 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119492 predicted 639
2 SASI_Rn01_00119493 predicted 674
3 SASI_Rn01_00119494 predicted 860
4 SASI_Rn01_00119495 predicted 817
5 SASI_Rn01_00119496 predicted 437
6 SASI_Rn01_00119498 predicted 667
7 SASI_Rn01_00119499 predicted 773
8 SASI_Rn01_00119500 predicted 605
9 SASI_Rn01_00119501 predicted 366
10 SASI_Rn02_00202911 predicted 683
11 SASI_Rn01_00119497 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190475 predicted 429
2 SASI_Mm01_00190476 predicted 990
3 SASI_Mm01_00190477 predicted 927
4 SASI_Mm01_00190478 predicted 556
5 SASI_Mm01_00190479 predicted 708
6 SASI_Mm01_00190481 predicted 440
7 SASI_Mm01_00190482 predicted 710
8 SASI_Mm01_00190483 predicted 1007
9 SASI_Mm02_00348222 predicted 390
10 SASI_Mm02_00348223 predicted 504
11 SASI_Mm01_00190474 predicted 435
12 SASI_Mm01_00190480 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007268
VSIG4 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-1260s1c1
Sequence:CCGGGCCAGGATCTGCTGACATAATCTCGAGATTATGTCAGCAGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-798s1c1
Sequence:CCGGGAAAGCAACATCTACAGTGAACTCGAGTTCACTGTAGATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007268.1-1624s1c1
Sequence:CCGGCCAGGATCATTTCTCTTTCTTCTCGAGAAGAAAGAGAAATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-518s1c1
Sequence:CCGGGAATGAGGATTAGCCTTCAATCTCGAGATTGAAGGCTAATCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007268.1-1516s1c1
Sequence:CCGGGCACTAGGACTTGGTCATCATCTCGAGATGATGACCAAGTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-450s1c1
Sequence:CCGGCCAGAAACTCTCTGTCTCCAACTCGAGTTGGAGACAGAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-588s1c1
Sequence:CCGGGACTAATAACCAGGAACCCATCTCGAGATGGGTTCCTGGTTATTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-621s1c1
Sequence:CCGGCCTAAGTACCTTACTCTTCAACTCGAGTTGAAGAGTAAGGTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-605s1c1
Sequence:CCGGCCATCAAAGTAGCAACCCTAACTCGAGTTAGGGTTGCTACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007268
VSIG4 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-1260s1c1
Sequence:CCGGGCCAGGATCTGCTGACATAATCTCGAGATTATGTCAGCAGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-798s1c1
Sequence:CCGGGAAAGCAACATCTACAGTGAACTCGAGTTCACTGTAGATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007268.1-1624s1c1
Sequence:CCGGCCAGGATCATTTCTCTTTCTTCTCGAGAAGAAAGAGAAATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-518s1c1
Sequence:CCGGGAATGAGGATTAGCCTTCAATCTCGAGATTGAAGGCTAATCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007268.1-1516s1c1
Sequence:CCGGGCACTAGGACTTGGTCATCATCTCGAGATGATGACCAAGTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-450s1c1
Sequence:CCGGCCAGAAACTCTCTGTCTCCAACTCGAGTTGGAGACAGAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-588s1c1
Sequence:CCGGGACTAATAACCAGGAACCCATCTCGAGATGGGTTCCTGGTTATTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-621s1c1
Sequence:CCGGCCTAAGTACCTTACTCTTCAACTCGAGTTGAAGAGTAAGGTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-605s1c1
Sequence:CCGGCCATCAAAGTAGCAACCCTAACTCGAGTTAGGGTTGCTACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007268
VSIG4 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-1260s1c1
Sequence:CCGGGCCAGGATCTGCTGACATAATCTCGAGATTATGTCAGCAGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-798s1c1
Sequence:CCGGGAAAGCAACATCTACAGTGAACTCGAGTTCACTGTAGATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007268.1-1624s1c1
Sequence:CCGGCCAGGATCATTTCTCTTTCTTCTCGAGAAGAAAGAGAAATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-518s1c1
Sequence:CCGGGAATGAGGATTAGCCTTCAATCTCGAGATTGAAGGCTAATCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007268.1-1516s1c1
Sequence:CCGGGCACTAGGACTTGGTCATCATCTCGAGATGATGACCAAGTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-450s1c1
Sequence:CCGGCCAGAAACTCTCTGTCTCCAACTCGAGTTGGAGACAGAGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-588s1c1
Sequence:CCGGGACTAATAACCAGGAACCCATCTCGAGATGGGTTCCTGGTTATTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007268.1-621s1c1
Sequence:CCGGCCTAAGTACCTTACTCTTCAACTCGAGTTGAAGAGTAAGGTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007268.1-605s1c1
Sequence:CCGGCCATCAAAGTAGCAACCCTAACTCGAGTTAGGGTTGCTACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177789
VSIG4 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1237s1c1
Sequence:CCGGCCATAGCAGTAGAGGTTCTTTCTCGAGAAAGAACCTCTACTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-825s1c1
Sequence:CCGGGCTCTGATTAGTGACTACTCTCTCGAGAGAGTAGTCACTAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-468s1c1
Sequence:CCGGCTCCGTGTTCGGAAATATAATCTCGAGATTATATTTCCGAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-326s1c1
Sequence:CCGGCCTGAAAGTGAGCCACAAAGTCTCGAGACTTTGTGGCTCACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1108s1c1
Sequence:CCGGCCATTGAGAAATCCTGGGTTTCTCGAGAAACCCAGGATTTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-429s1c1
Sequence:CCGGCCTGATGGAAACCAAGTAATACTCGAGTATTACTTGGTTTCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-821s1c1
Sequence:CCGGCCAGGCTCTGATTAGTGACTACTCGAGTAGTCACTAATCAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-561s21c1
Sequence:CCGGCCTCTGACTTGACCACTAATGCTCGAGCATTAGTGGTCAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.4-351s1c1
Sequence:CCGGGAGATGTGTCCCTCCAAATAACTCGAGTTATTTGGAGGGACACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-478s21c1
Sequence:CCGGGAAATATAATCCACCTAGAATCTCGAGATTCTAGGTGGATTATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177789
VSIG4 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1237s1c1
Sequence:CCGGCCATAGCAGTAGAGGTTCTTTCTCGAGAAAGAACCTCTACTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-825s1c1
Sequence:CCGGGCTCTGATTAGTGACTACTCTCTCGAGAGAGTAGTCACTAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-468s1c1
Sequence:CCGGCTCCGTGTTCGGAAATATAATCTCGAGATTATATTTCCGAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-326s1c1
Sequence:CCGGCCTGAAAGTGAGCCACAAAGTCTCGAGACTTTGTGGCTCACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1108s1c1
Sequence:CCGGCCATTGAGAAATCCTGGGTTTCTCGAGAAACCCAGGATTTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-429s1c1
Sequence:CCGGCCTGATGGAAACCAAGTAATACTCGAGTATTACTTGGTTTCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-821s1c1
Sequence:CCGGCCAGGCTCTGATTAGTGACTACTCGAGTAGTCACTAATCAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-561s21c1
Sequence:CCGGCCTCTGACTTGACCACTAATGCTCGAGCATTAGTGGTCAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.4-351s1c1
Sequence:CCGGGAGATGTGTCCCTCCAAATAACTCGAGTTATTTGGAGGGACACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-478s21c1
Sequence:CCGGGAAATATAATCCACCTAGAATCTCGAGATTCTAGGTGGATTATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177789
VSIG4 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1237s1c1
Sequence:CCGGCCATAGCAGTAGAGGTTCTTTCTCGAGAAAGAACCTCTACTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-825s1c1
Sequence:CCGGGCTCTGATTAGTGACTACTCTCTCGAGAGAGTAGTCACTAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-468s1c1
Sequence:CCGGCTCCGTGTTCGGAAATATAATCTCGAGATTATATTTCCGAACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.2-326s1c1
Sequence:CCGGCCTGAAAGTGAGCCACAAAGTCTCGAGACTTTGTGGCTCACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177789.2-1108s1c1
Sequence:CCGGCCATTGAGAAATCCTGGGTTTCTCGAGAAACCCAGGATTTCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-429s1c1
Sequence:CCGGCCTGATGGAAACCAAGTAATACTCGAGTATTACTTGGTTTCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177789.2-821s1c1
Sequence:CCGGCCAGGCTCTGATTAGTGACTACTCGAGTAGTCACTAATCAGAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-561s21c1
Sequence:CCGGCCTCTGACTTGACCACTAATGCTCGAGCATTAGTGGTCAAGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177789.4-351s1c1
Sequence:CCGGGAGATGTGTCCCTCCAAATAACTCGAGTTATTTGGAGGGACACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177789.4-478s21c1
Sequence:CCGGGAAATATAATCCACCTAGAATCTCGAGATTCTAGGTGGATTATATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks