EMAIL THIS PAGE TO A FRIEND

VSIG8

V-set and immunoglobulin domain containing 8

UniProtKB ID: Q5VU13, Q5VU14
Gene ID:
Mouse(240916) V-set and immunoglobulin domain containing 8
Rat(289236) V-set and immunoglobulin domain containing 8
domestic guinea pig(100727929) V-set and immunoglobulin domain containing 8
naked mole-rat(101697042) V-set and immunoglobulin domain containing 8
cow(520493) V-set and immunoglobulin domain containing 8
sheep(101123344) V-set and immunoglobulin domain containing 8
dog(100683194) V-set and immunoglobulin domain containing 8
domestic cat(101098428) V-set and immunoglobulin domain containing 8
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013661 Rosetta Predictions human pricing
NM_001105972 Rosetta Predictions rat pricing
NM_177723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246020 predicted 468
2 SASI_Hs01_00246021 predicted 346
3 SASI_Hs01_00246022 predicted 459
4 SASI_Hs01_00246023 predicted 587
5 SASI_Hs01_00246024 predicted 228
6 SASI_Hs01_00246025 predicted 503
7 SASI_Hs01_00246026 predicted 612
8 SASI_Hs01_00246027 predicted 470
9 SASI_Hs01_00246028 predicted 489
10 SASI_Hs01_00246029 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214362 predicted 744
2 SASI_Rn02_00214363 predicted 626
3 SASI_Rn02_00214364 predicted 330
4 SASI_Rn02_00214365 predicted 505
5 SASI_Rn02_00214366 predicted 467
6 SASI_Rn02_00214367 predicted 545
7 SASI_Rn02_00214368 predicted 493
8 SASI_Rn02_00214369 predicted 564
9 SASI_Rn02_00214370 predicted 1096
10 SASI_Rn02_00214371 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348079 predicted 277
2 SASI_Mm02_00348080 predicted 462
3 SASI_Mm02_00348081 predicted 496
4 SASI_Mm02_00348082 predicted 457
5 SASI_Mm02_00348083 predicted 613
6 SASI_Mm02_00348084 predicted 285
7 SASI_Mm02_00348085 predicted 1484
8 SASI_Mm02_00348086 predicted 1497
9 SASI_Mm02_00348087 predicted 1083
10 SASI_Mm02_00348088 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013661
VSIG8 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-703s21c1
Sequence:CCGGCTATCGAGCTGGGTCTTACACCTCGAGGTGTAAGACCCAGCTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-828s21c1
Sequence:CCGGGAGCAGATGATGGGCTGTATCCTCGAGGATACAGCCCATCATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-804s21c1
Sequence:CCGGACCTGGTGTTGAAGGATATCTCTCGAGAGATATCCTTCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-489s21c1
Sequence:CCGGTATCTGATACAGCCACTTATGCTCGAGCATAAGTGGCTGTATCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-353s1c1
Sequence:CCGGCGAGAGAACGTGTTCCTTAGTCTCGAGACTAAGGAACACGTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1505s1c1
Sequence:CCGGGTGAAGGCATTTCCCTAAGGACTCGAGTCCTTAGGGAAATGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-620s1c1
Sequence:CCGGGATGTGGTGCTGAAGTGCTATCTCGAGATAGCACTTCAGCACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-778s1c1
Sequence:CCGGCATAAACCAAGGCCTGAACAACTCGAGTTGTTCAGGCCTTGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1507s1c1
Sequence:CCGGGAAGGCATTTCCCTAAGGAAACTCGAGTTTCCTTAGGGAAATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013661
VSIG8 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-703s21c1
Sequence:CCGGCTATCGAGCTGGGTCTTACACCTCGAGGTGTAAGACCCAGCTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-828s21c1
Sequence:CCGGGAGCAGATGATGGGCTGTATCCTCGAGGATACAGCCCATCATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-804s21c1
Sequence:CCGGACCTGGTGTTGAAGGATATCTCTCGAGAGATATCCTTCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-489s21c1
Sequence:CCGGTATCTGATACAGCCACTTATGCTCGAGCATAAGTGGCTGTATCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-353s1c1
Sequence:CCGGCGAGAGAACGTGTTCCTTAGTCTCGAGACTAAGGAACACGTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1505s1c1
Sequence:CCGGGTGAAGGCATTTCCCTAAGGACTCGAGTCCTTAGGGAAATGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-620s1c1
Sequence:CCGGGATGTGGTGCTGAAGTGCTATCTCGAGATAGCACTTCAGCACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-778s1c1
Sequence:CCGGCATAAACCAAGGCCTGAACAACTCGAGTTGTTCAGGCCTTGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1507s1c1
Sequence:CCGGGAAGGCATTTCCCTAAGGAAACTCGAGTTTCCTTAGGGAAATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013661
VSIG8 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-703s21c1
Sequence:CCGGCTATCGAGCTGGGTCTTACACCTCGAGGTGTAAGACCCAGCTCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-828s21c1
Sequence:CCGGGAGCAGATGATGGGCTGTATCCTCGAGGATACAGCCCATCATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-804s21c1
Sequence:CCGGACCTGGTGTTGAAGGATATCTCTCGAGAGATATCCTTCAACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013661.1-489s21c1
Sequence:CCGGTATCTGATACAGCCACTTATGCTCGAGCATAAGTGGCTGTATCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-353s1c1
Sequence:CCGGCGAGAGAACGTGTTCCTTAGTCTCGAGACTAAGGAACACGTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1505s1c1
Sequence:CCGGGTGAAGGCATTTCCCTAAGGACTCGAGTCCTTAGGGAAATGCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-620s1c1
Sequence:CCGGGATGTGGTGCTGAAGTGCTATCTCGAGATAGCACTTCAGCACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013661.1-778s1c1
Sequence:CCGGCATAAACCAAGGCCTGAACAACTCGAGTTGTTCAGGCCTTGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013661.1-1507s1c1
Sequence:CCGGGAAGGCATTTCCCTAAGGAAACTCGAGTTTCCTTAGGGAAATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177723
VSIG8 MISSION shRNA Bacterial Glycerol Stock
V-set and immunoglobulin domain containing 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-307s1c1
Sequence:CCGGCTGGACATTGAGTGGATGCAACTCGAGTTGCATCCACTCAATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-1086s1c1
Sequence:CCGGCTTGGCTAGTGAGATCAGAGTCTCGAGACTCTGATCTCACTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-484s1c1
Sequence:CCGGGTATCTGACACAGCAACCTATCTCGAGATAGGTTGCTGTGTCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-182s1c1
Sequence:CCGGCAGCACTGTTGTCTGCTGTAACTCGAGTTACAGCAGACAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-312s1c1
Sequence:CCGGCATTGAGTGGATGCAAGTCAACTCGAGTTGACTTGCATCCACTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-373s1c1
Sequence:CCGGCAAGACAAGAGGATAGGTCATCTCGAGATGACCTATCCTCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-732s1c1
Sequence:CCGGCTTCCACTCTGAGCTTTCTTACTCGAGTAAGAAAGCTCAGAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-598s1c1
Sequence:CCGGCACATGTCAAAGGGCAACGATCTCGAGATCGTTGCCCTTTGACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-378s1c1
Sequence:CCGGCAAGAGGATAGGTCATGGCAACTCGAGTTGCCATGACCTATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177723
VSIG8 MISSION shRNA shRNA Plasmid DNA
V-set and immunoglobulin domain containing 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-307s1c1
Sequence:CCGGCTGGACATTGAGTGGATGCAACTCGAGTTGCATCCACTCAATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-1086s1c1
Sequence:CCGGCTTGGCTAGTGAGATCAGAGTCTCGAGACTCTGATCTCACTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-484s1c1
Sequence:CCGGGTATCTGACACAGCAACCTATCTCGAGATAGGTTGCTGTGTCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-182s1c1
Sequence:CCGGCAGCACTGTTGTCTGCTGTAACTCGAGTTACAGCAGACAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-312s1c1
Sequence:CCGGCATTGAGTGGATGCAAGTCAACTCGAGTTGACTTGCATCCACTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-373s1c1
Sequence:CCGGCAAGACAAGAGGATAGGTCATCTCGAGATGACCTATCCTCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-732s1c1
Sequence:CCGGCTTCCACTCTGAGCTTTCTTACTCGAGTAAGAAAGCTCAGAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-598s1c1
Sequence:CCGGCACATGTCAAAGGGCAACGATCTCGAGATCGTTGCCCTTTGACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-378s1c1
Sequence:CCGGCAAGAGGATAGGTCATGGCAACTCGAGTTGCCATGACCTATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177723
VSIG8 MISSION shRNA Lentiviral Transduction Particles
V-set and immunoglobulin domain containing 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-307s1c1
Sequence:CCGGCTGGACATTGAGTGGATGCAACTCGAGTTGCATCCACTCAATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-1086s1c1
Sequence:CCGGCTTGGCTAGTGAGATCAGAGTCTCGAGACTCTGATCTCACTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-484s1c1
Sequence:CCGGGTATCTGACACAGCAACCTATCTCGAGATAGGTTGCTGTGTCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-182s1c1
Sequence:CCGGCAGCACTGTTGTCTGCTGTAACTCGAGTTACAGCAGACAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-312s1c1
Sequence:CCGGCATTGAGTGGATGCAAGTCAACTCGAGTTGACTTGCATCCACTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-373s1c1
Sequence:CCGGCAAGACAAGAGGATAGGTCATCTCGAGATGACCTATCCTCTTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-732s1c1
Sequence:CCGGCTTCCACTCTGAGCTTTCTTACTCGAGTAAGAAAGCTCAGAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177723.2-598s1c1
Sequence:CCGGCACATGTCAAAGGGCAACGATCTCGAGATCGTTGCCCTTTGACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177723.2-378s1c1
Sequence:CCGGCAAGAGGATAGGTCATGGCAACTCGAGTTGCCATGACCTATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks