EMAIL THIS PAGE TO A FRIEND

VSNL1

visinin-like 1

Synonyms: HLP3 HPCAL3 HUVISL1 VILIP VILIP-1
UniProtKB ID: P62760, D6W515, P28677, P29103, P42323, Q9UM20
Gene ID:
Human(7447) Summary: This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(26950) visinin-like 1
Rat(24877) visinin-like 1
chicken(396189) visinin-like 1
domestic cat(101083074) visinin-like 1
dog(610447) visinin-like 1
cow(282124) visinin-like 1
sheep(101122768) visinin-like 1
naked mole-rat(101716324) visinin-like 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003385 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003385 Rosetta Predictions human pricing
NM_012686 Rosetta Predictions rat pricing
NM_012038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057333 predicted 1450
2 SASI_Hs01_00057334 predicted 687
3 SASI_Hs01_00057335 predicted 1294
4 SASI_Hs01_00057336 predicted 1437
5 SASI_Hs01_00057337 predicted 529
6 SASI_Hs01_00057338 predicted 1367
7 SASI_Hs01_00057339 predicted 1334
8 SASI_Hs01_00057340 predicted 1341
9 SASI_Hs01_00057341 predicted 1293
10 SASI_Hs01_00057342 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089841 predicted 1204
2 SASI_Rn01_00089842 predicted 510
3 SASI_Rn01_00089843 predicted 477
4 SASI_Rn01_00089844 predicted 1287
5 SASI_Rn01_00089845 predicted 1303
6 SASI_Rn01_00089846 predicted 1215
7 SASI_Rn01_00089848 predicted 302
8 SASI_Rn01_00089850 predicted 1146
9 SASI_Rn02_00259985 predicted 1265
10 SASI_Rn02_00259986 predicted 273
11 SASI_Rn01_00089847 predicted 599
12 SASI_Rn01_00089849 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188239 predicted 398
2 SASI_Mm01_00188240 predicted 1183
3 SASI_Mm01_00188241 predicted 386
4 SASI_Mm01_00188242 predicted 563
5 SASI_Mm01_00188243 predicted 328
6 SASI_Mm01_00188244 predicted 539
7 SASI_Mm01_00188245 predicted 1325
8 SASI_Mm01_00188246 predicted 486
9 SASI_Mm01_00188247 predicted 1339
10 SASI_Mm01_00188248 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012038
VSNL1 MISSION shRNA Bacterial Glycerol Stock
visinin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012038.3-1389s1c1
Sequence:CCGGGCCTTAATTCTTACCTCATTTCTCGAGAAATGAGGTAAGAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-625s1c1
Sequence:CCGGGCTGGAGATTATCGAGGCTATCTCGAGATAGCCTCGATAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-406s1c1
Sequence:CCGGCCAGCAGCTCTATGTGAAGTTCTCGAGAACTTCACATAGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-569s1c1
Sequence:CCGGTGGGCTTTCAACATGTATGATCTCGAGATCATACATGTTGAAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-324s1c1
Sequence:CCGGAGTTCAATGAGCATGAGCTTACTCGAGTAAGCTCATGCTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012038
VSNL1 MISSION shRNA shRNA Plasmid DNA
visinin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012038.3-1389s1c1
Sequence:CCGGGCCTTAATTCTTACCTCATTTCTCGAGAAATGAGGTAAGAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-625s1c1
Sequence:CCGGGCTGGAGATTATCGAGGCTATCTCGAGATAGCCTCGATAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-406s1c1
Sequence:CCGGCCAGCAGCTCTATGTGAAGTTCTCGAGAACTTCACATAGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-569s1c1
Sequence:CCGGTGGGCTTTCAACATGTATGATCTCGAGATCATACATGTTGAAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-324s1c1
Sequence:CCGGAGTTCAATGAGCATGAGCTTACTCGAGTAAGCTCATGCTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012038
VSNL1 MISSION shRNA Lentiviral Transduction Particles
visinin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012038.3-1389s1c1
Sequence:CCGGGCCTTAATTCTTACCTCATTTCTCGAGAAATGAGGTAAGAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-625s1c1
Sequence:CCGGGCTGGAGATTATCGAGGCTATCTCGAGATAGCCTCGATAATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-406s1c1
Sequence:CCGGCCAGCAGCTCTATGTGAAGTTCTCGAGAACTTCACATAGAGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-569s1c1
Sequence:CCGGTGGGCTTTCAACATGTATGATCTCGAGATCATACATGTTGAAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012038.3-324s1c1
Sequence:CCGGAGTTCAATGAGCATGAGCTTACTCGAGTAAGCTCATGCTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003385
VSNL1 MISSION shRNA Bacterial Glycerol Stock
visinin-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-713s1c1
Sequence:CCGGCCAGATTACACTGGATGAATTCTCGAGAATTCATCCAGTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-753s1c1
Sequence:CCGGGACCCTTCCATTGTATTACTTCTCGAGAAGTAATACAATGGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-374s1c1
Sequence:CCGGCTATGTGAAGTTCTTTCCTTACTCGAGTAAGGAAAGAACTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-293s1c1
Sequence:CCGGGCATGAACTCAAGCAGTGGTACTCGAGTACCACTGCTTGAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-279s1c1
Sequence:CCGGACAGAGTTTAATGAGCATGAACTCGAGTTCATGCTCATTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003385.4-496s21c1
Sequence:CCGGTGTCCAAGTGGGAGGCTAAATCTCGAGATTTAGCCTCCCACTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1251s21c1
Sequence:CCGGATGTGCTGCAAAGAGTTATATCTCGAGATATAACTCTTTGCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1300s21c1
Sequence:CCGGCGTATCTCCTTGATTACATAACTCGAGTTATGTAATCAAGGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003385
VSNL1 MISSION shRNA shRNA Plasmid DNA
visinin-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-713s1c1
Sequence:CCGGCCAGATTACACTGGATGAATTCTCGAGAATTCATCCAGTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-753s1c1
Sequence:CCGGGACCCTTCCATTGTATTACTTCTCGAGAAGTAATACAATGGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-374s1c1
Sequence:CCGGCTATGTGAAGTTCTTTCCTTACTCGAGTAAGGAAAGAACTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-293s1c1
Sequence:CCGGGCATGAACTCAAGCAGTGGTACTCGAGTACCACTGCTTGAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-279s1c1
Sequence:CCGGACAGAGTTTAATGAGCATGAACTCGAGTTCATGCTCATTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003385.4-496s21c1
Sequence:CCGGTGTCCAAGTGGGAGGCTAAATCTCGAGATTTAGCCTCCCACTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1251s21c1
Sequence:CCGGATGTGCTGCAAAGAGTTATATCTCGAGATATAACTCTTTGCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1300s21c1
Sequence:CCGGCGTATCTCCTTGATTACATAACTCGAGTTATGTAATCAAGGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003385
VSNL1 MISSION shRNA Lentiviral Transduction Particles
visinin-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-713s1c1
Sequence:CCGGCCAGATTACACTGGATGAATTCTCGAGAATTCATCCAGTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-753s1c1
Sequence:CCGGGACCCTTCCATTGTATTACTTCTCGAGAAGTAATACAATGGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-374s1c1
Sequence:CCGGCTATGTGAAGTTCTTTCCTTACTCGAGTAAGGAAAGAACTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-293s1c1
Sequence:CCGGGCATGAACTCAAGCAGTGGTACTCGAGTACCACTGCTTGAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003385.3-279s1c1
Sequence:CCGGACAGAGTTTAATGAGCATGAACTCGAGTTCATGCTCATTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003385.4-496s21c1
Sequence:CCGGTGTCCAAGTGGGAGGCTAAATCTCGAGATTTAGCCTCCCACTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1251s21c1
Sequence:CCGGATGTGCTGCAAAGAGTTATATCTCGAGATATAACTCTTTGCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003385.4-1300s21c1
Sequence:CCGGCGTATCTCCTTGATTACATAACTCGAGTTATGTAATCAAGGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks