EMAIL THIS PAGE TO A FRIEND

VSTM1

V-set and transmembrane domain containing 1

Synonyms: SIRL1 UNQ3033
UniProtKB ID: Q6UX27, D2DJS3, Q496B6, Q496B7
Gene ID:
Mouse(100041095) V-set and transmembrane domain containing 1
domestic cat(101084405) V-set and transmembrane domain containing 1
dog(611492) V-set and transmembrane domain containing 1
cow(618514) V-set and transmembrane domain containing 1
sheep(101119153) V-set and transmembrane domain containing 1
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155381 MISSION® esiRNA esiRNA human VSTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198481 Rosetta Predictions human pricing
XM_001475796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219129 predicted 544
2 SASI_Hs02_00372024 predicted 579
3 SASI_Hs01_00219130 predicted 684
4 SASI_Hs01_00219131 predicted 306
5 SASI_Hs01_00219133 predicted 726
6 SASI_Hs02_00372025 predicted 322
7 SASI_Hs01_00219134 predicted 478
8 SASI_Hs01_00219135 predicted 384
9 SASI_Hs02_00372026 predicted 523
10 SASI_Hs01_00219136 predicted 209
11 SASI_Hs01_00219128 predicted 657
12 SASI_Hs01_00219132 predicted 329
13 SASI_Hs01_00219137 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385019 predicted 207
2 SASI_Mm02_00385020 predicted 238
3 SASI_Mm02_00385021 predicted 229
4 SASI_Mm02_00385022 predicted 240
5 SASI_Mm02_00385023 predicted 212
6 SASI_Mm02_00385024 predicted 295
7 SASI_Mm02_00385025 predicted 207
8 SASI_Mm02_00385026 predicted 224
9 SASI_Mm02_00385027 predicted 298
10 SASI_Mm02_00385028 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198481
VSTM1 MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-385s21c1
Sequence:CCGGAGGAACAGAGCTCGGCAGAAACTCGAGTTTCTGCCGAGCTCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-440s21c1
Sequence:CCGGTAAGGATGCTGGGAGGTACTTCTCGAGAAGTACCTCCCAGCATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-862s21c1
Sequence:CCGGATGAATATGCGGCACTGAAAGCTCGAGCTTTCAGTGCCGCATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-793s1c1
Sequence:CCGGGAGTGACCTATGCTGAGCTAACTCGAGTTAGCTCAGCATAGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-534s1c1
Sequence:CCGGGTCACAGATAAACACGATGAACTCGAGTTCATCGTGTTTATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-339s1c1
Sequence:CCGGCATTCCCAGAATGTGACATTTCTCGAGAAATGTCACATTCTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-752s1c1
Sequence:CCGGCAATATGGAAAGGGTATCTCTCTCGAGAGAGATACCCTTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-503s1c1
Sequence:CCGGGTCAGAAAGCAGTGAACACTTCTCGAGAAGTGTTCACTGCTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-531s1c1
Sequence:CCGGGTGGTCACAGATAAACACGATCTCGAGATCGTGTTTATCTGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198481
VSTM1 MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-385s21c1
Sequence:CCGGAGGAACAGAGCTCGGCAGAAACTCGAGTTTCTGCCGAGCTCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-440s21c1
Sequence:CCGGTAAGGATGCTGGGAGGTACTTCTCGAGAAGTACCTCCCAGCATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-862s21c1
Sequence:CCGGATGAATATGCGGCACTGAAAGCTCGAGCTTTCAGTGCCGCATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-793s1c1
Sequence:CCGGGAGTGACCTATGCTGAGCTAACTCGAGTTAGCTCAGCATAGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-534s1c1
Sequence:CCGGGTCACAGATAAACACGATGAACTCGAGTTCATCGTGTTTATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-339s1c1
Sequence:CCGGCATTCCCAGAATGTGACATTTCTCGAGAAATGTCACATTCTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-752s1c1
Sequence:CCGGCAATATGGAAAGGGTATCTCTCTCGAGAGAGATACCCTTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-503s1c1
Sequence:CCGGGTCAGAAAGCAGTGAACACTTCTCGAGAAGTGTTCACTGCTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-531s1c1
Sequence:CCGGGTGGTCACAGATAAACACGATCTCGAGATCGTGTTTATCTGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198481
VSTM1 MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-385s21c1
Sequence:CCGGAGGAACAGAGCTCGGCAGAAACTCGAGTTTCTGCCGAGCTCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-440s21c1
Sequence:CCGGTAAGGATGCTGGGAGGTACTTCTCGAGAAGTACCTCCCAGCATCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198481.3-862s21c1
Sequence:CCGGATGAATATGCGGCACTGAAAGCTCGAGCTTTCAGTGCCGCATATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-793s1c1
Sequence:CCGGGAGTGACCTATGCTGAGCTAACTCGAGTTAGCTCAGCATAGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-534s1c1
Sequence:CCGGGTCACAGATAAACACGATGAACTCGAGTTCATCGTGTTTATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-339s1c1
Sequence:CCGGCATTCCCAGAATGTGACATTTCTCGAGAAATGTCACATTCTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-752s1c1
Sequence:CCGGCAATATGGAAAGGGTATCTCTCTCGAGAGAGATACCCTTTCCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-503s1c1
Sequence:CCGGGTCAGAAAGCAGTGAACACTTCTCGAGAAGTGTTCACTGCTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198481.1-531s1c1
Sequence:CCGGGTGGTCACAGATAAACACGATCTCGAGATCGTGTTTATCTGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks