EMAIL THIS PAGE TO A FRIEND

VSTM2A

V-set and transmembrane domain containing 2A

Synonyms: VSTM2
UniProtKB ID: Q8TAG5, A4D2E9, B5MC94
Gene ID:
Mouse(211739) V-set and transmembrane domain containing 2A
Rat(689106) V-set and transmembrane domain containing 2A
cow(782902) V-set and transmembrane domain containing 2A
naked mole-rat(101724726) V-set and transmembrane domain containing 2A
chicken(420951) V-set and transmembrane domain containing 2A
domestic cat(101084180) V-set and transmembrane domain containing 2A
dog(608324) V-set and transmembrane domain containing 2A
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182546 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121311 MISSION® esiRNA esiRNA human VSTM2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182546 Rosetta Predictions human pricing
XM_001069552 Rosetta Predictions rat pricing
NM_145967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370653 predicted 718
2 SASI_Hs01_00138334 predicted 419
3 SASI_Hs02_00370654 predicted 685
4 SASI_Hs01_00138339 predicted 701
5 SASI_Hs02_00370655 predicted 571
6 SASI_Hs01_00138335 predicted 1014
7 SASI_Hs01_00138342 predicted 490
8 SASI_Hs02_00370656 predicted 1046
9 SASI_Hs02_00370657 predicted 826
10 SASI_Hs02_00370658 predicted 688
11 SASI_Hs01_00138336 predicted 1259
12 SASI_Hs01_00138337 predicted 1022
13 SASI_Hs01_00138338 predicted 969
14 SASI_Hs01_00138340 predicted 1244
15 SASI_Hs01_00138341 predicted 976
16 SASI_Hs01_00138343 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328431 predicted 862
2 SASI_Rn02_00328432 predicted 847
3 SASI_Rn02_00328433 predicted 591
4 SASI_Rn02_00328434 predicted 585
5 SASI_Rn02_00328435 predicted 538
6 SASI_Rn02_00328436 predicted 347
7 SASI_Rn02_00328437 predicted 866
8 SASI_Rn02_00328438 predicted 537
9 SASI_Rn02_00328439 predicted 651
10 SASI_Rn02_00328440 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099691 predicted 569
2 SASI_Mm01_00099692 predicted 1021
3 SASI_Mm01_00099693 predicted 514
4 SASI_Mm01_00099694 predicted 534
5 SASI_Mm01_00099695 predicted 842
6 SASI_Mm01_00099696 predicted 279
7 SASI_Mm01_00099697 predicted 543
8 SASI_Mm02_00341454 predicted 719
9 SASI_Mm01_00099698 predicted 877
10 SASI_Mm01_00099699 predicted 708
11 SASI_Mm01_00099700 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145967
VSTM2A MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-878s1c1
Sequence:CCGGGATAGCTACAAGCCATGGACTCTCGAGAGTCCATGGCTTGTAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-563s1c1
Sequence:CCGGCCACAAGCTTCAGATATCCAACTCGAGTTGGATATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-291s1c1
Sequence:CCGGGTACAACAAGGGCTTTCTTCTCTCGAGAGAAGAAAGCCCTTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145967.1-2965s1c1
Sequence:CCGGGCTTTAAGAATCCCATACATTCTCGAGAATGTATGGGATTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-521s1c1
Sequence:CCGGGACCAAGATTAGTACAGTGAACTCGAGTTCACTGTACTAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-712s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145967.2-1171s21c1
Sequence:CCGGGACACTGTCACACGCTTTATTCTCGAGAATAAAGCGTGTGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-981s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-328s21c1
Sequence:CCGGCCGTGTTATATGTACAACAAGCTCGAGCTTGTTGTACATATAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145967
VSTM2A MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-878s1c1
Sequence:CCGGGATAGCTACAAGCCATGGACTCTCGAGAGTCCATGGCTTGTAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-563s1c1
Sequence:CCGGCCACAAGCTTCAGATATCCAACTCGAGTTGGATATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-291s1c1
Sequence:CCGGGTACAACAAGGGCTTTCTTCTCTCGAGAGAAGAAAGCCCTTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145967.1-2965s1c1
Sequence:CCGGGCTTTAAGAATCCCATACATTCTCGAGAATGTATGGGATTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-521s1c1
Sequence:CCGGGACCAAGATTAGTACAGTGAACTCGAGTTCACTGTACTAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-712s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145967.2-1171s21c1
Sequence:CCGGGACACTGTCACACGCTTTATTCTCGAGAATAAAGCGTGTGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-981s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-328s21c1
Sequence:CCGGCCGTGTTATATGTACAACAAGCTCGAGCTTGTTGTACATATAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145967
VSTM2A MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-878s1c1
Sequence:CCGGGATAGCTACAAGCCATGGACTCTCGAGAGTCCATGGCTTGTAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-563s1c1
Sequence:CCGGCCACAAGCTTCAGATATCCAACTCGAGTTGGATATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-291s1c1
Sequence:CCGGGTACAACAAGGGCTTTCTTCTCTCGAGAGAAGAAAGCCCTTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145967.1-2965s1c1
Sequence:CCGGGCTTTAAGAATCCCATACATTCTCGAGAATGTATGGGATTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145967.1-521s1c1
Sequence:CCGGGACCAAGATTAGTACAGTGAACTCGAGTTCACTGTACTAATCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-712s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145967.2-1171s21c1
Sequence:CCGGGACACTGTCACACGCTTTATTCTCGAGAATAAAGCGTGTGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-981s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145967.2-328s21c1
Sequence:CCGGCCGTGTTATATGTACAACAAGCTCGAGCTTGTTGTACATATAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182546
VSTM2A MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1402s1c1
Sequence:CCGGGCTGCCTGTGATGATGATAATCTCGAGATTATCATCATCACAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-707s1c1
Sequence:CCGGCCAAGCCTATCTGAAAGTCAACTCGAGTTGACTTTCAGATAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-618s1c1
Sequence:CCGGCAGATTTCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-608s1c1
Sequence:CCGGCCACAAGCTTCAGATTTCCAACTCGAGTTGGAAATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1575s1c1
Sequence:CCGGGCAGTCATTCAGCCAATGGAACTCGAGTTCCATTGGCTGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-578s1c1
Sequence:CCGGCACAGTGAAAGTCCAAGGCAACTCGAGTTGCCTTGGACTTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-894s1c1
Sequence:CCGGCCCAAACAAAGTCCACAATCACTCGAGTGATTGTGGACTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-584s1c1
Sequence:CCGGGAAAGTCCAAGGCAATGACATCTCGAGATGTCATTGCCTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1050s21c1
Sequence:CCGGAGCTACAAGCCATGGACTTTCCTCGAGGAAAGTCCATGGCTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-833s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1102s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182546
VSTM2A MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1402s1c1
Sequence:CCGGGCTGCCTGTGATGATGATAATCTCGAGATTATCATCATCACAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-707s1c1
Sequence:CCGGCCAAGCCTATCTGAAAGTCAACTCGAGTTGACTTTCAGATAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-618s1c1
Sequence:CCGGCAGATTTCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-608s1c1
Sequence:CCGGCCACAAGCTTCAGATTTCCAACTCGAGTTGGAAATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1575s1c1
Sequence:CCGGGCAGTCATTCAGCCAATGGAACTCGAGTTCCATTGGCTGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-578s1c1
Sequence:CCGGCACAGTGAAAGTCCAAGGCAACTCGAGTTGCCTTGGACTTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-894s1c1
Sequence:CCGGCCCAAACAAAGTCCACAATCACTCGAGTGATTGTGGACTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-584s1c1
Sequence:CCGGGAAAGTCCAAGGCAATGACATCTCGAGATGTCATTGCCTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1050s21c1
Sequence:CCGGAGCTACAAGCCATGGACTTTCCTCGAGGAAAGTCCATGGCTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-833s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1102s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182546
VSTM2A MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1402s1c1
Sequence:CCGGGCTGCCTGTGATGATGATAATCTCGAGATTATCATCATCACAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-707s1c1
Sequence:CCGGCCAAGCCTATCTGAAAGTCAACTCGAGTTGACTTTCAGATAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-618s1c1
Sequence:CCGGCAGATTTCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-608s1c1
Sequence:CCGGCCACAAGCTTCAGATTTCCAACTCGAGTTGGAAATCTGAAGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182546.1-1575s1c1
Sequence:CCGGGCAGTCATTCAGCCAATGGAACTCGAGTTCCATTGGCTGAATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-578s1c1
Sequence:CCGGCACAGTGAAAGTCCAAGGCAACTCGAGTTGCCTTGGACTTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182546.1-894s1c1
Sequence:CCGGCCCAAACAAAGTCCACAATCACTCGAGTGATTGTGGACTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182546.1-584s1c1
Sequence:CCGGGAAAGTCCAAGGCAATGACATCTCGAGATGTCATTGCCTTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1050s21c1
Sequence:CCGGAGCTACAAGCCATGGACTTTCCTCGAGGAAAGTCCATGGCTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-833s21c1
Sequence:CCGGAGGCCTATCTGAAAGTCAATGCTCGAGCATTGACTTTCAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182546.2-1102s21c1
Sequence:CCGGGGTGCTTTGCTTTAATCTAAACTCGAGTTTAGATTAAAGCAAAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks