EMAIL THIS PAGE TO A FRIEND

VSTM2B

V-set and transmembrane domain containing 2B

UniProtKB ID: A6NLU5
Gene ID:
Mouse(58188) V-set and transmembrane domain containing 2B
Rat(361560) V-set and transmembrane domain containing 2B
dog(484614) V-set and transmembrane domain containing 2B
domestic cat(101086438) V-set and transmembrane domain containing 2B
naked mole-rat(101709321) V-set and transmembrane domain containing 2B
domestic guinea pig(100718932) V-set and transmembrane domain containing 2B
cow(790185) V-set and transmembrane domain containing 2B
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301328 ANTI-VSTM2B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013141 MISSION® esiRNA esiRNA targeting mouse Vstm2b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715383 Rosetta Predictions human pricing
XM_292785 Rosetta Predictions human pricing
XM_939057 Rosetta Predictions human pricing
NM_001108479 Rosetta Predictions rat pricing
NM_021387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403287 predicted 350
2 SASI_Hs02_00403288 predicted 2096
3 SASI_Hs02_00403289 predicted 547
4 SASI_Hs02_00403290 predicted 1423
5 SASI_Hs02_00403291 predicted 295
6 SASI_Hs02_00403292 predicted 513
7 SASI_Hs02_00403293 predicted 444
8 SASI_Hs02_00403294 predicted 454
9 SASI_Hs02_00403295 predicted 285
10 SASI_Hs02_00403296 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293490 predicted 1671
2 SASI_Hs01_00293491 predicted 1607
3 SASI_Hs01_00293492 predicted 1587
4 SASI_Hs01_00293493 predicted 1673
5 SASI_Hs01_00293494 predicted 1598
6 SASI_Hs01_00293495 predicted 1602
7 SASI_Hs01_00293496 predicted 1670
8 SASI_Hs01_00293497 predicted 1661
9 SASI_Hs01_00293498 predicted 1609
10 SASI_Hs01_00293499 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483442 predicted 910
2 SASI_Hs02_00483443 predicted 1601
3 SASI_Hs02_00483444 predicted 928
4 SASI_Hs02_00483445 predicted 913
5 SASI_Hs02_00483446 predicted 915
6 SASI_Hs02_00483447 predicted 911
7 SASI_Hs02_00483448 predicted 1036
8 SASI_Hs02_00483449 predicted 959
9 SASI_Hs02_00483450 predicted 957
10 SASI_Hs02_00483451 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239049 predicted 1022
2 SASI_Rn02_00239050 predicted 1410
3 SASI_Rn02_00239051 predicted 1461
4 SASI_Rn02_00239052 predicted 1362
5 SASI_Rn02_00239053 predicted 1028
6 SASI_Rn02_00239054 predicted 1472
7 SASI_Rn02_00239055 predicted 1134
8 SASI_Rn02_00239056 predicted 1513
9 SASI_Rn02_00239057 predicted 1161
10 SASI_Rn02_00239058 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074130 predicted 518
2 SASI_Mm01_00074131 predicted 482
3 SASI_Mm02_00325979 predicted 1065
4 SASI_Mm01_00074132 predicted 468
5 SASI_Mm01_00074133 predicted 438
6 SASI_Mm01_00074134 predicted 441
7 SASI_Mm01_00074136 predicted 657
8 SASI_Mm02_00325980 predicted 618
9 SASI_Mm01_00074137 predicted 999
10 SASI_Mm01_00074138 predicted 497
11 SASI_Mm01_00074135 predicted 893
12 SASI_Mm01_00074139 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146339
VSTM2B MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1036s21c1
Sequence:CCGGTGCATCTAGTTTCCAAATAATCTCGAGATTATTTGGAAACTAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-811s21c1
Sequence:CCGGCTCCTGTTAGCTCTGCATAAGCTCGAGCTTATGCAGAGCTAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-172s21c1
Sequence:CCGGTCGTATTCGCTGGAGATTCAGCTCGAGCTGAATCTCCAGCGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-258s21c1
Sequence:CCGGCCGGAGCAAGGTAACAAATAACTCGAGTTATTTGTTACCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1011s21c1
Sequence:CCGGCACAAATGTAGAACACCTAAACTCGAGTTTAGGTGTTCTACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146339
VSTM2B MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1036s21c1
Sequence:CCGGTGCATCTAGTTTCCAAATAATCTCGAGATTATTTGGAAACTAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-811s21c1
Sequence:CCGGCTCCTGTTAGCTCTGCATAAGCTCGAGCTTATGCAGAGCTAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-172s21c1
Sequence:CCGGTCGTATTCGCTGGAGATTCAGCTCGAGCTGAATCTCCAGCGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-258s21c1
Sequence:CCGGCCGGAGCAAGGTAACAAATAACTCGAGTTATTTGTTACCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1011s21c1
Sequence:CCGGCACAAATGTAGAACACCTAAACTCGAGTTTAGGTGTTCTACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146339
VSTM2B MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1036s21c1
Sequence:CCGGTGCATCTAGTTTCCAAATAATCTCGAGATTATTTGGAAACTAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-811s21c1
Sequence:CCGGCTCCTGTTAGCTCTGCATAAGCTCGAGCTTATGCAGAGCTAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-172s21c1
Sequence:CCGGTCGTATTCGCTGGAGATTCAGCTCGAGCTGAATCTCCAGCGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146339.1-258s21c1
Sequence:CCGGCCGGAGCAAGGTAACAAATAACTCGAGTTATTTGTTACCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146339.1-1011s21c1
Sequence:CCGGCACAAATGTAGAACACCTAAACTCGAGTTTAGGTGTTCTACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021387
VSTM2B MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1221s1c1
Sequence:CCGGGCAAGTCCCTTGAGGATAGTACTCGAGTACTATCCTCAAGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-193s1c1
Sequence:CCGGCAAAGATGTAACCGTGCGAGACTCGAGTCTCGCACGGTTACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1017s1c1
Sequence:CCGGGCATGAAGAAGTCCATGCAAACTCGAGTTTGCATGGACTTCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-907s1c1
Sequence:CCGGGTTAGCACTACATAAGTTCCTCTCGAGAGGAACTTATGTAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021387
VSTM2B MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1221s1c1
Sequence:CCGGGCAAGTCCCTTGAGGATAGTACTCGAGTACTATCCTCAAGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-193s1c1
Sequence:CCGGCAAAGATGTAACCGTGCGAGACTCGAGTCTCGCACGGTTACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1017s1c1
Sequence:CCGGGCATGAAGAAGTCCATGCAAACTCGAGTTTGCATGGACTTCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-907s1c1
Sequence:CCGGGTTAGCACTACATAAGTTCCTCTCGAGAGGAACTTATGTAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021387
VSTM2B MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1221s1c1
Sequence:CCGGGCAAGTCCCTTGAGGATAGTACTCGAGTACTATCCTCAAGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-193s1c1
Sequence:CCGGCAAAGATGTAACCGTGCGAGACTCGAGTCTCGCACGGTTACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021387.1-1017s1c1
Sequence:CCGGGCATGAAGAAGTCCATGCAAACTCGAGTTTGCATGGACTTCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021387.1-907s1c1
Sequence:CCGGGTTAGCACTACATAAGTTCCTCTCGAGAGGAACTTATGTAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks