EMAIL THIS PAGE TO A FRIEND

VSTM2L

V-set and transmembrane domain containing 2 like

Synonyms: C20orf102 dJ1118M15.2
UniProtKB ID: Q96N03, E1P5V7, Q5JWZ4, Q5JWZ5, Q8ND45, Q9BR37
Gene ID:
Mouse(277432) V-set and transmembrane domain containing 2-like
cow(527903) V-set and transmembrane domain containing 2 like
sheep(101122879) V-set and transmembrane domain containing 2 like
domestic guinea pig(100729803) V-set and transmembrane domain containing 2 like
naked mole-rat(101701362) V-set and transmembrane domain containing 2 like
Zebrafish(393468) V-set and transmembrane domain containing 2 like
chicken(419297) V-set and transmembrane domain containing 2 like
domestic cat(101099452) V-set and transmembrane domain containing 2 like
dog(609224) V-set and transmembrane domain containing 2 like
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019071 MISSION® esiRNA esiRNA targeting human C20orf102 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080607 Rosetta Predictions human pricing
NM_198627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236671 predicted 1306
2 SASI_Hs01_00236672 predicted 1310
3 SASI_Hs02_00362354 predicted 455
4 SASI_Hs01_00236673 predicted 1301
5 SASI_Hs01_00236674 predicted 461
6 SASI_Hs01_00236676 predicted 1251
7 SASI_Hs01_00236675 predicted 1307
8 SASI_Hs01_00236678 predicted 675
9 SASI_Hs01_00236679 predicted 898
10 SASI_Hs01_00236680 predicted 638
11 SASI_Hs01_00236677 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351076 predicted 313
2 SASI_Mm02_00351077 predicted 301
3 SASI_Mm02_00351078 predicted 406
4 SASI_Mm02_00351079 predicted 308
5 SASI_Mm02_00351080 predicted 403
6 SASI_Mm02_00351081 predicted 399
7 SASI_Mm02_00351082 predicted 427
8 SASI_Mm02_00351083 predicted 431
9 SASI_Mm02_00351084 predicted 424
10 SASI_Mm02_00351085 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198627
VSTM2L MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2 like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-511s1c1
Sequence:CCGGGCGTGTGCTTTGCTTGCTTATCTCGAGATAAGCAAGCAAAGCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-611s1c1
Sequence:CCGGCTGTTCCTCATCATTCTACCTCTCGAGAGGTAGAATGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-865s1c1
Sequence:CCGGCCCTGGTGGTTTGTAAATATTCTCGAGAATATTTACAAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-862s1c1
Sequence:CCGGCCACCCTGGTGGTTTGTAAATCTCGAGATTTACAAACCACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198627
VSTM2L MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2 like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-511s1c1
Sequence:CCGGGCGTGTGCTTTGCTTGCTTATCTCGAGATAAGCAAGCAAAGCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-611s1c1
Sequence:CCGGCTGTTCCTCATCATTCTACCTCTCGAGAGGTAGAATGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-865s1c1
Sequence:CCGGCCCTGGTGGTTTGTAAATATTCTCGAGAATATTTACAAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-862s1c1
Sequence:CCGGCCACCCTGGTGGTTTGTAAATCTCGAGATTTACAAACCACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198627
VSTM2L MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2 like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-511s1c1
Sequence:CCGGGCGTGTGCTTTGCTTGCTTATCTCGAGATAAGCAAGCAAAGCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198627.1-611s1c1
Sequence:CCGGCTGTTCCTCATCATTCTACCTCTCGAGAGGTAGAATGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-865s1c1
Sequence:CCGGCCCTGGTGGTTTGTAAATATTCTCGAGAATATTTACAAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198627.1-862s1c1
Sequence:CCGGCCACCCTGGTGGTTTGTAAATCTCGAGATTTACAAACCACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080607
VSTM2L MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 2 like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080607.2-1791s21c1
Sequence:CCGGTATTTCTATTGGACCCAATTCCTCGAGGAATTGGGTCCAATAGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-614s21c1
Sequence:CCGGCAGCAACATCTCCCACAAGCTCTCGAGAGCTTGTGGGAGATGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-530s21c1
Sequence:CCGGGTGGGCCTCGAACCAGCTAAACTCGAGTTTAGCTGGTTCGAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-477s21c1
Sequence:CCGGGAGATCCAGTGGTGGTATGTACTCGAGTACATACCACCACTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-676s21c1
Sequence:CCGGAGTGCCGCGTCATCGACTTCACTCGAGTGAAGTCGATGACGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080607
VSTM2L MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 2 like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080607.2-1791s21c1
Sequence:CCGGTATTTCTATTGGACCCAATTCCTCGAGGAATTGGGTCCAATAGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-614s21c1
Sequence:CCGGCAGCAACATCTCCCACAAGCTCTCGAGAGCTTGTGGGAGATGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-530s21c1
Sequence:CCGGGTGGGCCTCGAACCAGCTAAACTCGAGTTTAGCTGGTTCGAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-477s21c1
Sequence:CCGGGAGATCCAGTGGTGGTATGTACTCGAGTACATACCACCACTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-676s21c1
Sequence:CCGGAGTGCCGCGTCATCGACTTCACTCGAGTGAAGTCGATGACGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080607
VSTM2L MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 2 like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080607.2-1791s21c1
Sequence:CCGGTATTTCTATTGGACCCAATTCCTCGAGGAATTGGGTCCAATAGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-614s21c1
Sequence:CCGGCAGCAACATCTCCCACAAGCTCTCGAGAGCTTGTGGGAGATGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-530s21c1
Sequence:CCGGGTGGGCCTCGAACCAGCTAAACTCGAGTTTAGCTGGTTCGAGGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-477s21c1
Sequence:CCGGGAGATCCAGTGGTGGTATGTACTCGAGTACATACCACCACTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080607.2-676s21c1
Sequence:CCGGAGTGCCGCGTCATCGACTTCACTCGAGTGAAGTCGATGACGCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks