EMAIL THIS PAGE TO A FRIEND

VSTM4

V-set and transmembrane domain containing 4

Synonyms: C10orf72
UniProtKB ID: Q8IW00, B4DNI6, Q96MX7
Gene ID:
Mouse(320736) V-set and transmembrane domain containing 4
Rat(361112) V-set and transmembrane domain containing 4
chicken(423782) V-set and transmembrane domain containing 4
dog(100685876) V-set and transmembrane domain containing 4
domestic cat(101095521) V-set and transmembrane domain containing 4
naked mole-rat(101717450) V-set and transmembrane domain containing 4
domestic guinea pig(100721779) V-set and transmembrane domain containing 4
cow(100336454) V-set and transmembrane domain containing 4
sheep(101116120) V-set and transmembrane domain containing 4
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031746 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031746 Rosetta Predictions human pricing
NM_144984 Rosetta Predictions human pricing
NM_001029920 Rosetta Predictions rat pricing
NM_178791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108253 predicted 1363
2 SASI_Hs02_00307806 predicted 1372
3 SASI_Hs01_00108254 predicted 632
4 SASI_Hs02_00307807 predicted 484
5 SASI_Hs01_00108255 predicted 1401
6 SASI_Hs01_00108256 predicted 486
7 SASI_Hs01_00108258 predicted 1209
8 SASI_Hs01_00108259 predicted 647
9 SASI_Hs01_00108261 predicted 945
10 SASI_Hs01_00108262 predicted 1402
11 SASI_Hs01_00108257 predicted 660
12 SASI_Hs01_00108260 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074073 predicted 666
2 SASI_Hs01_00074074 predicted 344
3 SASI_Hs01_00074075 predicted 550
4 SASI_Hs01_00074076 predicted 588
5 SASI_Hs01_00074077 predicted 520
6 SASI_Hs01_00074078 predicted 517
7 SASI_Hs02_00364792 predicted 703
8 SASI_Hs01_00074079 predicted 542
9 SASI_Hs01_00074080 predicted 373
10 SASI_Hs01_00074082 predicted 511
11 SASI_Hs01_00074081 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086091 predicted 735
2 SASI_Rn01_00086092 predicted 254
3 SASI_Rn01_00086094 predicted 1229
4 SASI_Rn01_00086095 predicted 950
5 SASI_Rn01_00086096 predicted 1271
6 SASI_Rn01_00086098 predicted 259
7 SASI_Rn01_00086099 predicted 1008
8 SASI_Rn02_00203488 predicted 546
9 SASI_Rn02_00203489 predicted 496
10 SASI_Rn02_00203490 predicted 804
11 SASI_Rn01_00086093 predicted 752
12 SASI_Rn01_00086097 predicted 1242
13 SASI_Rn01_00086100 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178875 predicted 1079
2 SASI_Mm01_00178877 predicted 1165
3 SASI_Mm01_00178878 predicted 1142
4 SASI_Mm02_00349390 predicted 1381
5 SASI_Mm01_00178879 predicted 889
6 SASI_Mm01_00178880 predicted 509
7 SASI_Mm01_00178881 predicted 1156
8 SASI_Mm01_00178882 predicted 1375
9 SASI_Mm01_00178884 predicted 677
10 SASI_Mm02_00349391 predicted 940
11 SASI_Mm01_00178876 predicted 977
12 SASI_Mm01_00178883 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178791
VSTM4 MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178791.2-939s1c1
Sequence:CCGGCCACCACTTTCCACAAACCAACTCGAGTTGGTTTGTGGAAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-2574s1c1
Sequence:CCGGCCGTGAATTGACATTTCTGAACTCGAGTTCAGAAATGTCAATTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-786s1c1
Sequence:CCGGGAGTGAGACATTATTTGGTGACTCGAGTCACCAAATAATGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-1591s1c1
Sequence:CCGGGCCACTTATGATGACATCCATCTCGAGATGGATGTCATCATAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-631s1c1
Sequence:CCGGCGAAGATTCATCATTTGAGAACTCGAGTTCTCAAATGATGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-597s1c1
Sequence:CCGGCGACGGAAATGAGAGTGATCTCTCGAGAGATCACTCTCATTTCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-962s1c1
Sequence:CCGGCTGCTGAAACCACAGAGGAAACTCGAGTTTCCTCTGTGGTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178791
VSTM4 MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178791.2-939s1c1
Sequence:CCGGCCACCACTTTCCACAAACCAACTCGAGTTGGTTTGTGGAAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-2574s1c1
Sequence:CCGGCCGTGAATTGACATTTCTGAACTCGAGTTCAGAAATGTCAATTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-786s1c1
Sequence:CCGGGAGTGAGACATTATTTGGTGACTCGAGTCACCAAATAATGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-1591s1c1
Sequence:CCGGGCCACTTATGATGACATCCATCTCGAGATGGATGTCATCATAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-631s1c1
Sequence:CCGGCGAAGATTCATCATTTGAGAACTCGAGTTCTCAAATGATGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-597s1c1
Sequence:CCGGCGACGGAAATGAGAGTGATCTCTCGAGAGATCACTCTCATTTCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-962s1c1
Sequence:CCGGCTGCTGAAACCACAGAGGAAACTCGAGTTTCCTCTGTGGTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178791
VSTM4 MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178791.2-939s1c1
Sequence:CCGGCCACCACTTTCCACAAACCAACTCGAGTTGGTTTGTGGAAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-2574s1c1
Sequence:CCGGCCGTGAATTGACATTTCTGAACTCGAGTTCAGAAATGTCAATTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-786s1c1
Sequence:CCGGGAGTGAGACATTATTTGGTGACTCGAGTCACCAAATAATGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178791.2-1591s1c1
Sequence:CCGGGCCACTTATGATGACATCCATCTCGAGATGGATGTCATCATAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-631s1c1
Sequence:CCGGCGAAGATTCATCATTTGAGAACTCGAGTTCTCAAATGATGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-597s1c1
Sequence:CCGGCGACGGAAATGAGAGTGATCTCTCGAGAGATCACTCTCATTTCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178791.2-962s1c1
Sequence:CCGGCTGCTGAAACCACAGAGGAAACTCGAGTTTCCTCTGTGGTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031746
VSTM4 MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-276s1c1
Sequence:CCGGGTGGTGCAGTACTATGGGAATCTCGAGATTCCCATAGTACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-651s1c1
Sequence:CCGGCGGAAATCCAGAGTGAGACATCTCGAGATGTCTCACTCTGGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-971s1c1
Sequence:CCGGCTTCGAGGAGAACAAGCTGTACTCGAGTACAGCTTGTTCTCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-825s1c1
Sequence:CCGGCATAAACCGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-248s1c1
Sequence:CCGGCTTGATGGTGAAGATGACCAACTCGAGTTGGTCATCTTCACCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-472s1c1
Sequence:CCGGCCACGGAAATGAGAGTCATTTCTCGAGAAATGACTCTCATTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-818s1c1
Sequence:CCGGCACGTTCCATAAACCGAAGCTCTCGAGAGCTTCGGTTTATGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-471s1c1
Sequence:CCGGGCCACGGAAATGAGAGTCATTCTCGAGAATGACTCTCATTTCCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-762s1c1
Sequence:CCGGCAGAAGGAGAAGCCTGACATTCTCGAGAATGTCAGGCTTCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031746.1-1415s1c1
Sequence:CCGGCCCAACTGTAAGATGGCACATCTCGAGATGTGCCATCTTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-965s1c1
Sequence:CCGGGATCCTCTTCGAGGAGAACAACTCGAGTTGTTCTCCTCGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031746
VSTM4 MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-276s1c1
Sequence:CCGGGTGGTGCAGTACTATGGGAATCTCGAGATTCCCATAGTACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-651s1c1
Sequence:CCGGCGGAAATCCAGAGTGAGACATCTCGAGATGTCTCACTCTGGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-971s1c1
Sequence:CCGGCTTCGAGGAGAACAAGCTGTACTCGAGTACAGCTTGTTCTCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-825s1c1
Sequence:CCGGCATAAACCGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-248s1c1
Sequence:CCGGCTTGATGGTGAAGATGACCAACTCGAGTTGGTCATCTTCACCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-472s1c1
Sequence:CCGGCCACGGAAATGAGAGTCATTTCTCGAGAAATGACTCTCATTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-818s1c1
Sequence:CCGGCACGTTCCATAAACCGAAGCTCTCGAGAGCTTCGGTTTATGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-471s1c1
Sequence:CCGGGCCACGGAAATGAGAGTCATTCTCGAGAATGACTCTCATTTCCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-762s1c1
Sequence:CCGGCAGAAGGAGAAGCCTGACATTCTCGAGAATGTCAGGCTTCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031746.1-1415s1c1
Sequence:CCGGCCCAACTGTAAGATGGCACATCTCGAGATGTGCCATCTTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-965s1c1
Sequence:CCGGGATCCTCTTCGAGGAGAACAACTCGAGTTGTTCTCCTCGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031746
VSTM4 MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-276s1c1
Sequence:CCGGGTGGTGCAGTACTATGGGAATCTCGAGATTCCCATAGTACTGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-651s1c1
Sequence:CCGGCGGAAATCCAGAGTGAGACATCTCGAGATGTCTCACTCTGGATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-971s1c1
Sequence:CCGGCTTCGAGGAGAACAAGCTGTACTCGAGTACAGCTTGTTCTCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-825s1c1
Sequence:CCGGCATAAACCGAAGCTGCTGAAACTCGAGTTTCAGCAGCTTCGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-248s1c1
Sequence:CCGGCTTGATGGTGAAGATGACCAACTCGAGTTGGTCATCTTCACCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-472s1c1
Sequence:CCGGCCACGGAAATGAGAGTCATTTCTCGAGAAATGACTCTCATTTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-818s1c1
Sequence:CCGGCACGTTCCATAAACCGAAGCTCTCGAGAGCTTCGGTTTATGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-471s1c1
Sequence:CCGGGCCACGGAAATGAGAGTCATTCTCGAGAATGACTCTCATTTCCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031746.1-762s1c1
Sequence:CCGGCAGAAGGAGAAGCCTGACATTCTCGAGAATGTCAGGCTTCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031746.1-1415s1c1
Sequence:CCGGCCCAACTGTAAGATGGCACATCTCGAGATGTGCCATCTTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031746.1-965s1c1
Sequence:CCGGGATCCTCTTCGAGGAGAACAACTCGAGTTGTTCTCCTCGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks