EMAIL THIS PAGE TO A FRIEND

VSTM5

V-set and transmembrane domain containing 5

Synonyms: C11orf90
UniProtKB ID: A8MXK1
Gene ID:
Mouse(69137) V-set and transmembrane domain containing 5
Rat(500947) V-set and transmembrane domain containing 5
chicken(100859821) V-set and transmembrane domain containing 5
domestic cat(101082178) V-set and transmembrane domain containing 5
dog(100683245) V-set and transmembrane domain containing 5
cow(100141246) V-set and transmembrane domain containing 5
sheep(101106473) V-set and transmembrane domain containing 5
domestic guinea pig(100722155) V-set and transmembrane domain containing 5
naked mole-rat(101706685) V-set and transmembrane domain containing 5
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001144871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144871 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012701 MISSION® esiRNA esiRNA targeting mouse 2200002K05Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718950 Rosetta Predictions human pricing
XM_370648 Rosetta Predictions human pricing
XM_936690 Rosetta Predictions human pricing
XM_001074484 Rosetta Predictions rat pricing
XM_576358 Rosetta Predictions rat pricing
NM_026955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427280 predicted 683
2 SASI_Hs02_00427281 predicted 1232
3 SASI_Hs02_00427282 predicted 1195
4 SASI_Hs02_00427283 predicted 1232
5 SASI_Hs02_00427284 predicted 1051
6 SASI_Hs02_00427285 predicted 1063
7 SASI_Hs02_00427286 predicted 909
8 SASI_Hs02_00427287 predicted 751
9 SASI_Hs02_00427288 predicted 685
10 SASI_Hs02_00427289 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479238 predicted 326
2 SASI_Hs02_00479239 predicted 314
3 SASI_Hs02_00479240 predicted 270
4 SASI_Hs02_00479241 predicted 270
5 SASI_Hs02_00479242 predicted 342
6 SASI_Hs02_00479243 predicted 204
7 SASI_Hs02_00479244 predicted 204
8 SASI_Hs02_00479245 predicted 329
9 SASI_Hs02_00479246 predicted 219
10 SASI_Hs02_00479247 predicted 216
11 SASI_Hs01_00288520 predicted 392
12 SASI_Hs01_00288521 predicted 486
13 SASI_Hs01_00288522 predicted 497
14 SASI_Hs01_00288523 predicted 481
15 SASI_Hs01_00288524 predicted 366
16 SASI_Hs01_00288525 predicted 479
17 SASI_Hs01_00288526 predicted 327
18 SASI_Hs01_00288527 predicted 316
19 SASI_Hs01_00288528 predicted 418
20 SASI_Hs01_00288529 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482181 predicted 490
2 SASI_Hs02_00482182 predicted 1029
3 SASI_Hs02_00482183 predicted 1004
4 SASI_Hs02_00482184 predicted 1028
5 SASI_Hs02_00482185 predicted 855
6 SASI_Hs02_00482186 predicted 865
7 SASI_Hs02_00482187 predicted 804
8 SASI_Hs02_00482188 predicted 707
9 SASI_Hs02_00482189 predicted 558
10 SASI_Hs02_00482190 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346413 predicted 556
2 SASI_Rn02_00346414 predicted 716
3 SASI_Rn02_00346415 predicted 570
4 SASI_Rn02_00346416 predicted 616
5 SASI_Rn02_00346417 predicted 662
6 SASI_Rn02_00346418 predicted 504
7 SASI_Rn02_00346419 predicted 552
8 SASI_Rn02_00346420 predicted 542
9 SASI_Rn02_00346421 predicted 408
10 SASI_Rn02_00346422 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405151 predicted 560
2 SASI_Rn02_00405152 predicted 714
3 SASI_Rn02_00405153 predicted 566
4 SASI_Rn02_00405154 predicted 616
5 SASI_Rn02_00405155 predicted 663
6 SASI_Rn02_00405156 predicted 510
7 SASI_Rn02_00405157 predicted 553
8 SASI_Rn02_00405158 predicted 548
9 SASI_Rn02_00405159 predicted 404
10 SASI_Rn02_00405160 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051509 predicted 340
2 SASI_Mm01_00051510 predicted 565
3 SASI_Mm01_00051511 predicted 548
4 SASI_Mm01_00051512 predicted 726
5 SASI_Mm01_00051513 predicted 727
6 SASI_Mm01_00051514 predicted 407
7 SASI_Mm01_00051515 predicted 1029
8 SASI_Mm01_00051516 predicted 979
9 SASI_Mm01_00051517 predicted 1019
10 SASI_Mm01_00051518 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026955
VSTM5 MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026955.1-840s1c1
Sequence:CCGGCCAATTACATTGCTACCTCAACTCGAGTTGAGGTAGCAATGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-410s1c1
Sequence:CCGGGCCCACTATTGAGTGGAAGTACTCGAGTACTTCCACTCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-547s1c1
Sequence:CCGGTCAATGTGAGTGTGAAGGATTCTCGAGAATCCTTCACACTCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-633s1c1
Sequence:CCGGCGTGTGTCTGAGATCCGCTATCTCGAGATAGCGGATCTCAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-733s1c1
Sequence:CCGGGCAATCAGTGTGCGTATAAATCTCGAGATTTATACGCACACTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026955
VSTM5 MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026955.1-840s1c1
Sequence:CCGGCCAATTACATTGCTACCTCAACTCGAGTTGAGGTAGCAATGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-410s1c1
Sequence:CCGGGCCCACTATTGAGTGGAAGTACTCGAGTACTTCCACTCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-547s1c1
Sequence:CCGGTCAATGTGAGTGTGAAGGATTCTCGAGAATCCTTCACACTCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-633s1c1
Sequence:CCGGCGTGTGTCTGAGATCCGCTATCTCGAGATAGCGGATCTCAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-733s1c1
Sequence:CCGGGCAATCAGTGTGCGTATAAATCTCGAGATTTATACGCACACTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026955
VSTM5 MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026955.1-840s1c1
Sequence:CCGGCCAATTACATTGCTACCTCAACTCGAGTTGAGGTAGCAATGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-410s1c1
Sequence:CCGGGCCCACTATTGAGTGGAAGTACTCGAGTACTTCCACTCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-547s1c1
Sequence:CCGGTCAATGTGAGTGTGAAGGATTCTCGAGAATCCTTCACACTCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-633s1c1
Sequence:CCGGCGTGTGTCTGAGATCCGCTATCTCGAGATAGCGGATCTCAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026955.1-733s1c1
Sequence:CCGGGCAATCAGTGTGCGTATAAATCTCGAGATTTATACGCACACTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144871
VSTM5 MISSION shRNA Bacterial Glycerol Stock
V-set and transmembrane domain containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-424s21c1
Sequence:CCGGCTCTATGAAGACCTGCACTTTCTCGAGAAAGTGCAGGTCTTCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-335s21c1
Sequence:CCGGTGAGGGATTCCGGCTACTATGCTCGAGCATAGTAGCCGGAATCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-113s21c1
Sequence:CCGGTTCCTCAGGCCACCATCAATGCTCGAGCATTGATGGTGGCCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-221s21c1
Sequence:CCGGGAACGCAGAAGATCGTGGAGTCTCGAGACTCCACGATCTTCTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-153s21c1
Sequence:CCGGCCTGCTCTCAGTTGAGTACTCCTCGAGGAGTACTCAACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-189s21c1
Sequence:CCGGCACCATCGAATGGACATATTCCTCGAGGAATATGTCCATTCGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-36s21c1
Sequence:CCGGAGGCATCTCCCTAGGACTCTTCTCGAGAAGAGTCCTAGGGAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144871
VSTM5 MISSION shRNA shRNA Plasmid DNA
V-set and transmembrane domain containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-424s21c1
Sequence:CCGGCTCTATGAAGACCTGCACTTTCTCGAGAAAGTGCAGGTCTTCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-335s21c1
Sequence:CCGGTGAGGGATTCCGGCTACTATGCTCGAGCATAGTAGCCGGAATCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-113s21c1
Sequence:CCGGTTCCTCAGGCCACCATCAATGCTCGAGCATTGATGGTGGCCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-221s21c1
Sequence:CCGGGAACGCAGAAGATCGTGGAGTCTCGAGACTCCACGATCTTCTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-153s21c1
Sequence:CCGGCCTGCTCTCAGTTGAGTACTCCTCGAGGAGTACTCAACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-189s21c1
Sequence:CCGGCACCATCGAATGGACATATTCCTCGAGGAATATGTCCATTCGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-36s21c1
Sequence:CCGGAGGCATCTCCCTAGGACTCTTCTCGAGAAGAGTCCTAGGGAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144871
VSTM5 MISSION shRNA Lentiviral Transduction Particles
V-set and transmembrane domain containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-424s21c1
Sequence:CCGGCTCTATGAAGACCTGCACTTTCTCGAGAAAGTGCAGGTCTTCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-335s21c1
Sequence:CCGGTGAGGGATTCCGGCTACTATGCTCGAGCATAGTAGCCGGAATCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-113s21c1
Sequence:CCGGTTCCTCAGGCCACCATCAATGCTCGAGCATTGATGGTGGCCTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-221s21c1
Sequence:CCGGGAACGCAGAAGATCGTGGAGTCTCGAGACTCCACGATCTTCTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-153s21c1
Sequence:CCGGCCTGCTCTCAGTTGAGTACTCCTCGAGGAGTACTCAACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-189s21c1
Sequence:CCGGCACCATCGAATGGACATATTCCTCGAGGAATATGTCCATTCGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144871.1-36s21c1
Sequence:CCGGAGGCATCTCCCTAGGACTCTTCTCGAGAAGAGTCCTAGGGAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks