EMAIL THIS PAGE TO A FRIEND

VSX1

visual system homeobox 1

Synonyms: CAASDS KTCN KTCN1 PPCD PPD RINX
Gene ID:
Human(30813) Summary: The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(114889) visual system homeobox 1 homolog (zebrafish)
Rat(689704) visual system homeobox 1
naked mole-rat(101722463) visual system homeobox 1
domestic guinea pig(100720734) visual system homeobox 1
cow(286802) visual system homeobox 1
sheep(101106277) visual system homeobox 1
fruit fly(31470) Visual system homeobox 1 ortholog
domestic cat(101090343) visual system homeobox 1
dog(608128) visual system homeobox 1
chicken(395537) visual system homeobox 1
Zebrafish(30598) visual system homeobox 1 homolog, chx10-like
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014588 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014588 Rosetta Predictions human pricing
NM_199425 Rosetta Predictions human pricing
NM_001109546 Rosetta Predictions rat pricing
NM_054068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056150 predicted 433
2 SASI_Hs01_00056151 predicted 431
3 SASI_Hs01_00056152 predicted 304
4 SASI_Hs01_00056153 predicted 436
5 SASI_Hs01_00056155 predicted 328
6 SASI_Hs01_00056156 predicted 305
7 SASI_Hs01_00056157 predicted 310
8 SASI_Hs01_00056154 predicted 418
9 SASI_Hs01_00056158 predicted 1560
10 SASI_Hs01_00056159 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046895 predicted 442
2 SASI_Hs01_00046896 predicted 433
3 SASI_Hs01_00046897 predicted 304
4 SASI_Hs01_00046898 predicted 441
5 SASI_Hs01_00046900 predicted 322
6 SASI_Hs01_00046901 predicted 314
7 SASI_Hs01_00046902 predicted 314
8 SASI_Hs01_00046899 predicted 422
9 SASI_Hs02_00372825 predicted 542
10 SASI_Hs01_00046903 predicted 610
11 SASI_Hs01_00046904 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249459 predicted 1274
2 SASI_Rn02_00249460 predicted 1406
3 SASI_Rn02_00249461 predicted 792
4 SASI_Rn02_00249462 predicted 1383
5 SASI_Rn02_00249463 predicted 1157
6 SASI_Rn02_00249464 predicted 1466
7 SASI_Rn02_00249465 predicted 1485
8 SASI_Rn02_00249466 predicted 1353
9 SASI_Rn02_00249467 predicted 904
10 SASI_Rn02_00249468 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181158 predicted 1342
2 SASI_Mm01_00181159 predicted 1164
3 SASI_Mm01_00181160 predicted 769
4 SASI_Mm01_00181161 predicted 334
5 SASI_Mm01_00181162 predicted 776
6 SASI_Mm02_00337995 predicted 710
7 SASI_Mm01_00181163 predicted 1337
8 SASI_Mm02_00337996 predicted 335
9 SASI_Mm01_00181164 predicted 773
10 SASI_Mm01_00181165 predicted 1376
11 SASI_Mm01_00181157 predicted 1263
12 SASI_Mm01_00181166 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014588
VSX1 MISSION shRNA Bacterial Glycerol Stock
visual system homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014588.4-919s21c1
Sequence:CCGGACCACTTCAAAGAAGGTTCTACTCGAGTAGAACCTTCTTTGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-615s1c1
Sequence:CCGGCGAGAAATGCTGGCTGTGAAACTCGAGTTTCACAGCCAGCATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-955s1c1
Sequence:CCGGGATCACAGAGAGGCTCAGATACTCGAGTATCTGAGCCTCTCTGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-776s1c1
Sequence:CCGGGCTGCCAGACTCCGTGCTCAACTCGAGTTGAGCACGGAGTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-878s1c1
Sequence:CCGGGCCAGGAAGTGAAGATAAGTTCTCGAGAACTTATCTTCACTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014588
VSX1 MISSION shRNA shRNA Plasmid DNA
visual system homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014588.4-919s21c1
Sequence:CCGGACCACTTCAAAGAAGGTTCTACTCGAGTAGAACCTTCTTTGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-615s1c1
Sequence:CCGGCGAGAAATGCTGGCTGTGAAACTCGAGTTTCACAGCCAGCATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-955s1c1
Sequence:CCGGGATCACAGAGAGGCTCAGATACTCGAGTATCTGAGCCTCTCTGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-776s1c1
Sequence:CCGGGCTGCCAGACTCCGTGCTCAACTCGAGTTGAGCACGGAGTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-878s1c1
Sequence:CCGGGCCAGGAAGTGAAGATAAGTTCTCGAGAACTTATCTTCACTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014588
VSX1 MISSION shRNA Lentiviral Transduction Particles
visual system homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014588.4-919s21c1
Sequence:CCGGACCACTTCAAAGAAGGTTCTACTCGAGTAGAACCTTCTTTGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-615s1c1
Sequence:CCGGCGAGAAATGCTGGCTGTGAAACTCGAGTTTCACAGCCAGCATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-955s1c1
Sequence:CCGGGATCACAGAGAGGCTCAGATACTCGAGTATCTGAGCCTCTCTGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-776s1c1
Sequence:CCGGGCTGCCAGACTCCGTGCTCAACTCGAGTTGAGCACGGAGTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014588.4-878s1c1
Sequence:CCGGGCCAGGAAGTGAAGATAAGTTCTCGAGAACTTATCTTCACTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054068
VSX1 MISSION shRNA Bacterial Glycerol Stock
visual system homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1693s21c1
Sequence:CCGGATTATTACTCCCTAGCATTATCTCGAGATAATGCTAGGGAGTAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1519s21c1
Sequence:CCGGTATGACGTCGCTTAGTTAATACTCGAGTATTAACTAAGCGACGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1346s21c1
Sequence:CCGGGCAACACTACAACACTGAATACTCGAGTATTCAGTGTTGTAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-258s1c1
Sequence:CCGGCCTTCGAAGCTTTGCCATCAACTCGAGTTGATGGCAAAGCTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-778s1c1
Sequence:CCGGCGGGAAATGCTGGCTGCGAAACTCGAGTTTCGCAGCCAGCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1125s1c1
Sequence:CCGGGCCAGACGAAACAACCCAGAACTCGAGTTCTGGGTTGTTTCGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-813s1c1
Sequence:CCGGAGACCGAATACAGGTCTGGTTCTCGAGAACCAGACCTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1065s1c1
Sequence:CCGGCTGGGAGTTTGACCATCTCAACTCGAGTTGAGATGGTCAAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054068
VSX1 MISSION shRNA shRNA Plasmid DNA
visual system homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1693s21c1
Sequence:CCGGATTATTACTCCCTAGCATTATCTCGAGATAATGCTAGGGAGTAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1519s21c1
Sequence:CCGGTATGACGTCGCTTAGTTAATACTCGAGTATTAACTAAGCGACGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1346s21c1
Sequence:CCGGGCAACACTACAACACTGAATACTCGAGTATTCAGTGTTGTAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-258s1c1
Sequence:CCGGCCTTCGAAGCTTTGCCATCAACTCGAGTTGATGGCAAAGCTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-778s1c1
Sequence:CCGGCGGGAAATGCTGGCTGCGAAACTCGAGTTTCGCAGCCAGCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1125s1c1
Sequence:CCGGGCCAGACGAAACAACCCAGAACTCGAGTTCTGGGTTGTTTCGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-813s1c1
Sequence:CCGGAGACCGAATACAGGTCTGGTTCTCGAGAACCAGACCTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1065s1c1
Sequence:CCGGCTGGGAGTTTGACCATCTCAACTCGAGTTGAGATGGTCAAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054068
VSX1 MISSION shRNA Lentiviral Transduction Particles
visual system homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1693s21c1
Sequence:CCGGATTATTACTCCCTAGCATTATCTCGAGATAATGCTAGGGAGTAATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1519s21c1
Sequence:CCGGTATGACGTCGCTTAGTTAATACTCGAGTATTAACTAAGCGACGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054068.2-1346s21c1
Sequence:CCGGGCAACACTACAACACTGAATACTCGAGTATTCAGTGTTGTAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-258s1c1
Sequence:CCGGCCTTCGAAGCTTTGCCATCAACTCGAGTTGATGGCAAAGCTTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-778s1c1
Sequence:CCGGCGGGAAATGCTGGCTGCGAAACTCGAGTTTCGCAGCCAGCATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1125s1c1
Sequence:CCGGGCCAGACGAAACAACCCAGAACTCGAGTTCTGGGTTGTTTCGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-813s1c1
Sequence:CCGGAGACCGAATACAGGTCTGGTTCTCGAGAACCAGACCTGTATTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054068.2-1065s1c1
Sequence:CCGGCTGGGAGTTTGACCATCTCAACTCGAGTTGAGATGGTCAAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks