EMAIL THIS PAGE TO A FRIEND

VSX2

visual system homeobox 2

Synonyms: CHX10 HOX10 MCOP2 MCOPCB3 RET1
UniProtKB ID: P58304, A1A4X6
Gene ID:
Human(338917) Summary: This gene encodes a homeobox protein originally described as a retina-specific transcription factor. Mutations in this gene are associated with microphthalmia, cataracts and iris abnormalities. [provided by RefSeq, Oct 2009]
Mouse(12677) visual system homeobox 2
Rat(171360) visual system homeobox 2
fruit fly(31469) Visual system homeobox 2 ortholog
Zebrafish(796163) visual system homeobox 2
domestic cat(101093278) visual system homeobox 2
dog(490780) visual system homeobox 2
chicken(395536) visual system homeobox 2
cow(528647) visual system homeobox 2
sheep(101106436) visual system homeobox 2
domestic guinea pig(100732489) visual system homeobox 2
naked mole-rat(101702690) visual system homeobox 2
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136771 MISSION® esiRNA esiRNA human VSX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182894 Rosetta Predictions human pricing
XM_001058827 Rosetta Predictions rat pricing
XM_001058888 Rosetta Predictions rat pricing
XM_345704 Rosetta Predictions rat pricing
NM_007701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153798 predicted 1231
2 SASI_Hs01_00153799 predicted 1548
3 SASI_Hs01_00153800 predicted 1546
4 SASI_Hs01_00153801 predicted 1348
5 SASI_Hs01_00153802 predicted 1608
6 SASI_Hs01_00153803 predicted 1024
7 SASI_Hs01_00153804 predicted 988
8 SASI_Hs01_00153806 predicted 1595
9 SASI_Hs01_00153807 predicted 1489
10 SASI_Hs02_00370989 predicted 1156
11 SASI_Hs01_00153805 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290977 predicted 541
2 SASI_Rn02_00290978 predicted 449
3 SASI_Rn02_00290979 predicted 629
4 SASI_Rn02_00290980 predicted 972
5 SASI_Rn02_00290981 predicted 490
6 SASI_Rn02_00290982 predicted 681
7 SASI_Rn02_00290983 predicted 928
8 SASI_Rn02_00290984 predicted 684
9 SASI_Rn02_00290985 predicted 738
10 SASI_Rn02_00290986 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291177 predicted 543
2 SASI_Rn02_00291178 predicted 444
3 SASI_Rn02_00291179 predicted 631
4 SASI_Rn02_00291180 predicted 484
5 SASI_Rn02_00291181 predicted 628
6 SASI_Rn02_00291182 predicted 679
7 SASI_Rn02_00291183 predicted 682
8 SASI_Rn02_00291184 predicted 730
9 SASI_Rn02_00291185 predicted 628
10 SASI_Rn02_00291186 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398631 predicted 444
2 SASI_Rn02_00398632 predicted 976
3 SASI_Rn02_00398633 predicted 485
4 SASI_Rn02_00398634 predicted 478
5 SASI_Rn02_00398635 predicted 420
6 SASI_Rn02_00398636 predicted 426
7 SASI_Rn02_00398637 predicted 1017
8 SASI_Rn02_00398638 predicted 417
9 SASI_Rn02_00398639 predicted 974
10 SASI_Rn02_00398640 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201677 predicted 1326
2 SASI_Mm01_00201678 predicted 1488
3 SASI_Mm01_00201679 predicted 1318
4 SASI_Mm01_00201680 predicted 1349
5 SASI_Mm01_00201681 predicted 583
6 SASI_Mm01_00201682 predicted 491
7 SASI_Mm01_00201683 predicted 540
8 SASI_Mm02_00312262 predicted 547
9 SASI_Mm01_00201685 predicted 1490
10 SASI_Mm01_00201686 predicted 653
11 SASI_Mm01_00201684 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007701
VSX2 MISSION shRNA Bacterial Glycerol Stock
visual system homeobox 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-456s1c1
Sequence:CCGGGCTCCGATTCCGAAGATGTTTCTCGAGAAACATCTTCGGAATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-919s1c1
Sequence:CCGGCCTGCCCAAGCTCGACAAGATCTCGAGATCTTGTCGAGCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-809s1c1
Sequence:CCGGGCCAAGGATGGCATAATGGATCTCGAGATCCATTATGCCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-788s1c1
Sequence:CCGGCCAGAGTCTATCCTCAAGTCTCTCGAGAGACTTGAGGATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-544s1c1
Sequence:CCGGCAGGACAATCTTTACTTCCTACTCGAGTAGGAAGTAAAGATTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1491s21c1
Sequence:CCGGCCTTATTCTCTGCTCTCTAAGCTCGAGCTTAGAGAGCAGAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-738s21c1
Sequence:CCGGTGGCTGAGTATGGTCTCTATGCTCGAGCATAGAGACCATACTCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1313s21c1
Sequence:CCGGGACTCTAGAAACAGACCAATTCTCGAGAATTGGTCTGTTTCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-197s21c1
Sequence:CCGGGAGATCCTAGGCTTGAACAAGCTCGAGCTTGTTCAAGCCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007701
VSX2 MISSION shRNA shRNA Plasmid DNA
visual system homeobox 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-456s1c1
Sequence:CCGGGCTCCGATTCCGAAGATGTTTCTCGAGAAACATCTTCGGAATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-919s1c1
Sequence:CCGGCCTGCCCAAGCTCGACAAGATCTCGAGATCTTGTCGAGCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-809s1c1
Sequence:CCGGGCCAAGGATGGCATAATGGATCTCGAGATCCATTATGCCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-788s1c1
Sequence:CCGGCCAGAGTCTATCCTCAAGTCTCTCGAGAGACTTGAGGATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-544s1c1
Sequence:CCGGCAGGACAATCTTTACTTCCTACTCGAGTAGGAAGTAAAGATTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1491s21c1
Sequence:CCGGCCTTATTCTCTGCTCTCTAAGCTCGAGCTTAGAGAGCAGAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-738s21c1
Sequence:CCGGTGGCTGAGTATGGTCTCTATGCTCGAGCATAGAGACCATACTCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1313s21c1
Sequence:CCGGGACTCTAGAAACAGACCAATTCTCGAGAATTGGTCTGTTTCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-197s21c1
Sequence:CCGGGAGATCCTAGGCTTGAACAAGCTCGAGCTTGTTCAAGCCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007701
VSX2 MISSION shRNA Lentiviral Transduction Particles
visual system homeobox 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-456s1c1
Sequence:CCGGGCTCCGATTCCGAAGATGTTTCTCGAGAAACATCTTCGGAATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-919s1c1
Sequence:CCGGCCTGCCCAAGCTCGACAAGATCTCGAGATCTTGTCGAGCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-809s1c1
Sequence:CCGGGCCAAGGATGGCATAATGGATCTCGAGATCCATTATGCCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-788s1c1
Sequence:CCGGCCAGAGTCTATCCTCAAGTCTCTCGAGAGACTTGAGGATAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007701.2-544s1c1
Sequence:CCGGCAGGACAATCTTTACTTCCTACTCGAGTAGGAAGTAAAGATTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1491s21c1
Sequence:CCGGCCTTATTCTCTGCTCTCTAAGCTCGAGCTTAGAGAGCAGAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-738s21c1
Sequence:CCGGTGGCTGAGTATGGTCTCTATGCTCGAGCATAGAGACCATACTCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007701.2-1313s21c1
Sequence:CCGGGACTCTAGAAACAGACCAATTCTCGAGAATTGGTCTGTTTCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007701.2-197s21c1
Sequence:CCGGGAGATCCTAGGCTTGAACAAGCTCGAGCTTGTTCAAGCCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182894
VSX2 MISSION shRNA Bacterial Glycerol Stock
visual system homeobox 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-455s1c1
Sequence:CCGGGCTCGGATTCTGAAGATGTTTCTCGAGAAACATCTTCAGAATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-1027s1c1
Sequence:CCGGGCTCAGGAGCACAGCACCAAACTCGAGTTTGGTGCTGTGCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-466s1c1
Sequence:CCGGGAAGATGTTTCCTCCAGCGATCTCGAGATCGCTGGAGGAAACATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-787s1c1
Sequence:CCGGCCCGAGTCCATCCTCAAGTCACTCGAGTGACTTGAGGATGGACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-493s21c1
Sequence:CCGGATGTCCAAATCTGCTTTAAACCTCGAGGTTTAAAGCAGATTTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-586s21c1
Sequence:CCGGGCATTCAACGAAGCCCACTACCTCGAGGTAGTGGGCTTCGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1359s21c1
Sequence:CCGGAGACATCCCTCATCTAGTCTTCTCGAGAAGACTAGATGAGGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1550s21c1
Sequence:CCGGCTAAAGCCCATTGCTGCAAATCTCGAGATTTGCAGCAATGGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-727s21c1
Sequence:CCGGAGCAGTGTCATGGCGGAGTATCTCGAGATACTCCGCCATGACACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182894
VSX2 MISSION shRNA shRNA Plasmid DNA
visual system homeobox 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-455s1c1
Sequence:CCGGGCTCGGATTCTGAAGATGTTTCTCGAGAAACATCTTCAGAATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-1027s1c1
Sequence:CCGGGCTCAGGAGCACAGCACCAAACTCGAGTTTGGTGCTGTGCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-466s1c1
Sequence:CCGGGAAGATGTTTCCTCCAGCGATCTCGAGATCGCTGGAGGAAACATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-787s1c1
Sequence:CCGGCCCGAGTCCATCCTCAAGTCACTCGAGTGACTTGAGGATGGACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-493s21c1
Sequence:CCGGATGTCCAAATCTGCTTTAAACCTCGAGGTTTAAAGCAGATTTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-586s21c1
Sequence:CCGGGCATTCAACGAAGCCCACTACCTCGAGGTAGTGGGCTTCGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1359s21c1
Sequence:CCGGAGACATCCCTCATCTAGTCTTCTCGAGAAGACTAGATGAGGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1550s21c1
Sequence:CCGGCTAAAGCCCATTGCTGCAAATCTCGAGATTTGCAGCAATGGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-727s21c1
Sequence:CCGGAGCAGTGTCATGGCGGAGTATCTCGAGATACTCCGCCATGACACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182894
VSX2 MISSION shRNA Lentiviral Transduction Particles
visual system homeobox 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-455s1c1
Sequence:CCGGGCTCGGATTCTGAAGATGTTTCTCGAGAAACATCTTCAGAATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-1027s1c1
Sequence:CCGGGCTCAGGAGCACAGCACCAAACTCGAGTTTGGTGCTGTGCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-466s1c1
Sequence:CCGGGAAGATGTTTCCTCCAGCGATCTCGAGATCGCTGGAGGAAACATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182894.1-787s1c1
Sequence:CCGGCCCGAGTCCATCCTCAAGTCACTCGAGTGACTTGAGGATGGACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-493s21c1
Sequence:CCGGATGTCCAAATCTGCTTTAAACCTCGAGGTTTAAAGCAGATTTGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-586s21c1
Sequence:CCGGGCATTCAACGAAGCCCACTACCTCGAGGTAGTGGGCTTCGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1359s21c1
Sequence:CCGGAGACATCCCTCATCTAGTCTTCTCGAGAAGACTAGATGAGGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182894.2-1550s21c1
Sequence:CCGGCTAAAGCCCATTGCTGCAAATCTCGAGATTTGCAGCAATGGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182894.2-727s21c1
Sequence:CCGGAGCAGTGTCATGGCGGAGTATCTCGAGATACTCCGCCATGACACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks