EMAIL THIS PAGE TO A FRIEND

VTA1

vesicle (multivesicular body) trafficking 1

Synonyms: C6orf55 DRG-1 DRG1 LIP5 My012 SBP1
Gene ID:
Human(51534) Summary: C6ORF55 encodes a protein involved in trafficking of the multivesicular body, an endosomal compartment involved in sorting membrane proteins for degradation in lysosomes (Ward et al., 2005 [PubMed 15644320]
Mouse(66201) Vps20-associated 1 homolog (S. cerevisiae)
Rat(292640) Vps20-associated 1 homolog (S. cerevisiae)
Zebrafish(406414) Vps20-associated 1 homolog (S. cerevisiae)
domestic cat(101089360) Vps20-associated 1 homolog (S. cerevisiae)
dog(612830) Vps20-associated 1 homolog (S. cerevisiae)
chicken(421674) Vps20-associated 1 homolog (S. cerevisiae)
cow(506430) Vps20-associated 1 homolog (S. cerevisiae)
sheep(101116660) Vps20-associated 1 homolog (S. cerevisiae)
naked mole-rat(101696966) Vps20-associated 1 homolog (S. cerevisiae)
domestic guinea pig(100718295) Vps20-associated 1 homolog (S. cerevisiae)
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016485 Rosetta Predictions human pricing
NM_001025640 Rosetta Predictions rat pricing
NM_025418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100012 predicted 927
2 SASI_Hs01_00100013 predicted 823
3 SASI_Hs01_00100014 predicted 359
4 SASI_Hs01_00100015 predicted 241
5 SASI_Hs01_00100016 predicted 985
6 SASI_Hs01_00100017 predicted 595
7 SASI_Hs01_00100018 predicted 744
8 SASI_Hs01_00100019 predicted 727
9 SASI_Hs01_00100020 predicted 833
10 SASI_Hs01_00100021 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055464 predicted 889
2 SASI_Rn01_00055465 predicted 799
3 SASI_Rn01_00055466 predicted 581
4 SASI_Rn01_00055468 predicted 859
5 SASI_Rn01_00055469 predicted 711
6 SASI_Rn01_00055470 predicted 406
7 SASI_Rn01_00055471 predicted 468
8 SASI_Rn02_00203210 predicted 647
9 SASI_Rn02_00203211 predicted 433
10 SASI_Rn02_00203212 predicted 477
11 SASI_Rn01_00055467 predicted 476
12 SASI_Rn01_00055472 predicted 893
13 SASI_Rn01_00055473 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160178 predicted 709
2 SASI_Mm01_00160179 predicted 283
3 SASI_Mm01_00160180 predicted 1004
4 SASI_Mm02_00328197 predicted 1074
5 SASI_Mm01_00160181 predicted 773
6 SASI_Mm01_00160182 predicted 716
7 SASI_Mm01_00160183 predicted 842
8 SASI_Mm01_00160184 predicted 952
9 SASI_Mm01_00160185 predicted 986
10 SASI_Mm01_00160186 predicted 997
11 SASI_Mm01_00160187 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016485
VALIDATED
VTA1 MISSION shRNA Bacterial Glycerol Stock
vesicle (multivesicular body) trafficking 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-623s21c1
Sequence:GTACCGGACATGCCATCAGGCAACTATACTCGAGTATAGTTGCCTGATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-458s21c1
Sequence:GTACCGGAGGCAACATACATCCATAATTCTCGAGAATTATGGATGTATGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016485.3-1350s21c1
Sequence:GTACCGGAGATAGCCAGAATATTCTAAACTCGAGTTTAGAATATTCTGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-1685s1c1
Sequence:CCGGGCCTGGAAACTTGGTGCTTTACTCGAGTAAAGCACCAAGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-365s1c1
Sequence:CCGGCCTTCTATACTGCAAGTCTTTCTCGAGAAAGACTTGCAGTATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016485.3-707s1c1
Sequence:CCGGGCACAGGTGTAGCAAGTAATACTCGAGTATTACTTGCTACACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-842s1c1
Sequence:CCGGGCAAATATGCTGGCAGTGCTTCTCGAGAAGCACTGCCAGCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-456s1c1
Sequence:CCGGGAAGGCAACATACATCCATAACTCGAGTTATGGATGTATGTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016485
VALIDATED
VTA1 MISSION shRNA shRNA Plasmid DNA
vesicle (multivesicular body) trafficking 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-623s21c1
Sequence:GTACCGGACATGCCATCAGGCAACTATACTCGAGTATAGTTGCCTGATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-458s21c1
Sequence:GTACCGGAGGCAACATACATCCATAATTCTCGAGAATTATGGATGTATGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016485.3-1350s21c1
Sequence:GTACCGGAGATAGCCAGAATATTCTAAACTCGAGTTTAGAATATTCTGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-1685s1c1
Sequence:CCGGGCCTGGAAACTTGGTGCTTTACTCGAGTAAAGCACCAAGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-365s1c1
Sequence:CCGGCCTTCTATACTGCAAGTCTTTCTCGAGAAAGACTTGCAGTATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016485.3-707s1c1
Sequence:CCGGGCACAGGTGTAGCAAGTAATACTCGAGTATTACTTGCTACACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-842s1c1
Sequence:CCGGGCAAATATGCTGGCAGTGCTTCTCGAGAAGCACTGCCAGCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-456s1c1
Sequence:CCGGGAAGGCAACATACATCCATAACTCGAGTTATGGATGTATGTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016485
VALIDATED
VTA1 MISSION shRNA Lentiviral Transduction Particles
vesicle (multivesicular body) trafficking 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-623s21c1
Sequence:GTACCGGACATGCCATCAGGCAACTATACTCGAGTATAGTTGCCTGATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016485.3-458s21c1
Sequence:GTACCGGAGGCAACATACATCCATAATTCTCGAGAATTATGGATGTATGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016485.3-1350s21c1
Sequence:GTACCGGAGATAGCCAGAATATTCTAAACTCGAGTTTAGAATATTCTGGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-1685s1c1
Sequence:CCGGGCCTGGAAACTTGGTGCTTTACTCGAGTAAAGCACCAAGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016485.3-365s1c1
Sequence:CCGGCCTTCTATACTGCAAGTCTTTCTCGAGAAAGACTTGCAGTATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016485.3-707s1c1
Sequence:CCGGGCACAGGTGTAGCAAGTAATACTCGAGTATTACTTGCTACACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-842s1c1
Sequence:CCGGGCAAATATGCTGGCAGTGCTTCTCGAGAAGCACTGCCAGCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016485.3-456s1c1
Sequence:CCGGGAAGGCAACATACATCCATAACTCGAGTTATGGATGTATGTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025418
VALIDATED
VTA1 MISSION shRNA Bacterial Glycerol Stock
vesicle (multivesicular body) trafficking 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1116s21c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-848s21c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-185s21c1
Sequence:CCGGACTCCTGAGTGTCGTAAATTTCTCGAGAAATTTACGACACTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1008s21c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-604s21c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-140s1c1
Sequence:CCGGGTCGTTTATATGCTATGCAAACTCGAGTTTGCATAGCATATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-847s1c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1115s1c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-603s1c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1007s1c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025418
VALIDATED
VTA1 MISSION shRNA shRNA Plasmid DNA
vesicle (multivesicular body) trafficking 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1116s21c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-848s21c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-185s21c1
Sequence:CCGGACTCCTGAGTGTCGTAAATTTCTCGAGAAATTTACGACACTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1008s21c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-604s21c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-140s1c1
Sequence:CCGGGTCGTTTATATGCTATGCAAACTCGAGTTTGCATAGCATATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-847s1c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1115s1c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-603s1c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1007s1c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025418
VALIDATED
VTA1 MISSION shRNA Lentiviral Transduction Particles
vesicle (multivesicular body) trafficking 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1116s21c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-848s21c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-185s21c1
Sequence:CCGGACTCCTGAGTGTCGTAAATTTCTCGAGAAATTTACGACACTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-1008s21c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025418.3-604s21c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-140s1c1
Sequence:CCGGGTCGTTTATATGCTATGCAAACTCGAGTTTGCATAGCATATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-847s1c1
Sequence:CCGGGCTCAGAAGTACTGCAAGTATCTCGAGATACTTGCAGTACTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1115s1c1
Sequence:CCGGCCAGTTGTCATTGAGTGTGTACTCGAGTACACACTCAATGACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-603s1c1
Sequence:CCGGGCCATCATCATCTTCAGCATACTCGAGTATGCTGAAGATGATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025418.2-1007s1c1
Sequence:CCGGCGTTACACTTTCCTCAGCCTTCTCGAGAAGGCTGAGGAAAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks