EMAIL THIS PAGE TO A FRIEND

VTCN1

V-set domain containing T cell activation inhibitor 1

Synonyms: B7-H4 B7H4 B7S1 B7X B7h.5 PRO1291 VCTN1
UniProtKB ID: Q7Z7D3, Q0GN76, Q45VN0, Q5WPZ3, Q6P097, Q9H6B2
Gene ID:
Human(79679) Summary: This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(242122) V-set domain containing T cell activation inhibitor 1
Rat(295322) V-set domain containing T cell activation inhibitor 1
chicken(418323) V-set domain containing T cell activation inhibitor 1
domestic cat(101086586) V-set domain containing T cell activation inhibitor 1
dog(483140) V-set domain containing T cell activation inhibitor 1
cow(539919) V-set domain containing T cell activation inhibitor 1
sheep(101107915) V-set domain containing T cell activation inhibitor 1
domestic guinea pig(100713245) V-set domain containing T cell activation inhibitor 1
naked mole-rat(101720572) V-set domain containing T cell activation inhibitor 1
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024626 Rosetta Predictions human pricing
NM_001024244 Rosetta Predictions rat pricing
NM_178594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136017 predicted 389
2 SASI_Hs01_00136018 predicted 733
3 SASI_Hs01_00136019 predicted 528
4 SASI_Hs01_00136020 predicted 457
5 SASI_Hs01_00136021 predicted 479
6 SASI_Hs01_00136022 predicted 938
7 SASI_Hs01_00136023 predicted 372
8 SASI_Hs01_00136024 predicted 1017
9 SASI_Hs01_00136025 predicted 662
10 SASI_Hs02_00357006 predicted 270
11 SASI_Hs01_00136026 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072694 predicted 1054
2 SASI_Rn01_00072695 predicted 712
3 SASI_Rn01_00072696 predicted 1015
4 SASI_Rn01_00072697 predicted 808
5 SASI_Rn01_00072698 predicted 550
6 SASI_Rn01_00072699 predicted 757
7 SASI_Rn01_00072700 predicted 712
8 SASI_Rn01_00072701 predicted 502
9 SASI_Rn01_00072702 predicted 317
10 SASI_Rn02_00202394 predicted 584
11 SASI_Rn01_00072693 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348919 predicted 349
2 SASI_Mm01_00046743 predicted 919
3 SASI_Mm01_00046744 predicted 667
4 SASI_Mm01_00046745 predicted 705
5 SASI_Mm01_00046746 predicted 1091
6 SASI_Mm01_00046747 predicted 969
7 SASI_Mm01_00046748 predicted 768
8 SASI_Mm01_00046749 predicted 671
9 SASI_Mm01_00046750 predicted 458
10 SASI_Mm01_00046751 predicted 1007
11 SASI_Mm01_00046752 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024626
VTCN1 MISSION shRNA Bacterial Glycerol Stock
V-set domain containing T cell activation inhibitor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024626.1-1408s1c1
Sequence:CCGGGCTTCTAAGTTTCTTTCCCTTCTCGAGAAGGGAAAGAAACTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-709s1c1
Sequence:CCGGGCTCTACAATGTTACGATCAACTCGAGTTGATCGTAACATTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-248s1c1
Sequence:CCGGCCTGACATCAAACTTTCTGATCTCGAGATCAGAAAGTTTGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-311s1c1
Sequence:CCGGCATGAGTTCAAAGAAGGCAAACTCGAGTTTGCCTTCTTTGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-532s21c1
Sequence:CCGGGAAGTGAATGTGGACTATAATCTCGAGATTATAGTCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-488s21c1
Sequence:CCGGGGAATGCTAACCTTGAGTATACTCGAGTATACTCAAGGTTAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024626
VTCN1 MISSION shRNA shRNA Plasmid DNA
V-set domain containing T cell activation inhibitor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024626.1-1408s1c1
Sequence:CCGGGCTTCTAAGTTTCTTTCCCTTCTCGAGAAGGGAAAGAAACTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-709s1c1
Sequence:CCGGGCTCTACAATGTTACGATCAACTCGAGTTGATCGTAACATTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-248s1c1
Sequence:CCGGCCTGACATCAAACTTTCTGATCTCGAGATCAGAAAGTTTGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-311s1c1
Sequence:CCGGCATGAGTTCAAAGAAGGCAAACTCGAGTTTGCCTTCTTTGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-532s21c1
Sequence:CCGGGAAGTGAATGTGGACTATAATCTCGAGATTATAGTCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-488s21c1
Sequence:CCGGGGAATGCTAACCTTGAGTATACTCGAGTATACTCAAGGTTAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024626
VTCN1 MISSION shRNA Lentiviral Transduction Particles
V-set domain containing T cell activation inhibitor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024626.1-1408s1c1
Sequence:CCGGGCTTCTAAGTTTCTTTCCCTTCTCGAGAAGGGAAAGAAACTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-709s1c1
Sequence:CCGGGCTCTACAATGTTACGATCAACTCGAGTTGATCGTAACATTGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-248s1c1
Sequence:CCGGCCTGACATCAAACTTTCTGATCTCGAGATCAGAAAGTTTGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024626.1-311s1c1
Sequence:CCGGCATGAGTTCAAAGAAGGCAAACTCGAGTTTGCCTTCTTTGAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-532s21c1
Sequence:CCGGGAAGTGAATGTGGACTATAATCTCGAGATTATAGTCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024626.2-488s21c1
Sequence:CCGGGGAATGCTAACCTTGAGTATACTCGAGTATACTCAAGGTTAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178594
VTCN1 MISSION shRNA Bacterial Glycerol Stock
V-set domain containing T cell activation inhibitor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-250s21c1
Sequence:CCGGTCGTCATCCAGTGGCTGAAAGCTCGAGCTTTCAGCCACTGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178594.2-1128s21c1
Sequence:CCGGACCAAACTAGAGTATACTAAGCTCGAGCTTAGTATACTCTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-510s21c1
Sequence:CCGGGAGATAAATGTGGACTATAATCTCGAGATTATAGTCCACATTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-679s21c1
Sequence:CCGGTCGTATCTGTGCTCTACAATGCTCGAGCATTGTAGAGCACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-466s21c1
Sequence:CCGGGGAATGCAAACCTTGAGTATACTCGAGTATACTCAAGGTTTGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178594
VTCN1 MISSION shRNA shRNA Plasmid DNA
V-set domain containing T cell activation inhibitor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-250s21c1
Sequence:CCGGTCGTCATCCAGTGGCTGAAAGCTCGAGCTTTCAGCCACTGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178594.2-1128s21c1
Sequence:CCGGACCAAACTAGAGTATACTAAGCTCGAGCTTAGTATACTCTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-510s21c1
Sequence:CCGGGAGATAAATGTGGACTATAATCTCGAGATTATAGTCCACATTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-679s21c1
Sequence:CCGGTCGTATCTGTGCTCTACAATGCTCGAGCATTGTAGAGCACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-466s21c1
Sequence:CCGGGGAATGCAAACCTTGAGTATACTCGAGTATACTCAAGGTTTGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178594
VTCN1 MISSION shRNA Lentiviral Transduction Particles
V-set domain containing T cell activation inhibitor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-250s21c1
Sequence:CCGGTCGTCATCCAGTGGCTGAAAGCTCGAGCTTTCAGCCACTGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178594.2-1128s21c1
Sequence:CCGGACCAAACTAGAGTATACTAAGCTCGAGCTTAGTATACTCTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-510s21c1
Sequence:CCGGGAGATAAATGTGGACTATAATCTCGAGATTATAGTCCACATTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-679s21c1
Sequence:CCGGTCGTATCTGTGCTCTACAATGCTCGAGCATTGTAGAGCACAGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178594.2-466s21c1
Sequence:CCGGGGAATGCAAACCTTGAGTATACTCGAGTATACTCAAGGTTTGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks