EMAIL THIS PAGE TO A FRIEND

VTI1A

vesicle transport through interaction with t-SNAREs 1A

Synonyms: MMDS3 MVti1 VTI1RP2 Vti1-rp2
UniProtKB ID: Q96AJ9, A2A307, B4E137, Q5W0D7
Gene ID:
Mouse(53611) vesicle transport through interaction with t-SNAREs 1A
Rat(65277) vesicle transport through interaction with t-SNAREs 1A
Zebrafish(567385) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
chicken(770885) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
domestic cat(101095380) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
Horse(100068586) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
dog(100685447) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
naked mole-rat(101719787) vesicle transport through interaction with t-SNAREs 1A
domestic guinea pig(100716285) vesicle transport through interaction with t-SNAREs 1A
cow(780850) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
sheep(101121988) vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145206 Rosetta Predictions human pricing
NM_023101 Rosetta Predictions rat pricing
XM_579476 Rosetta Predictions rat pricing
NM_016862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112834 predicted 511
2 SASI_Hs02_00365049 predicted 851
3 SASI_Hs02_00365050 predicted 743
4 SASI_Hs02_00365051 predicted 1226
5 SASI_Hs01_00112839 predicted 601
6 SASI_Hs02_00365052 predicted 1022
7 SASI_Hs02_00365053 predicted 1191
8 SASI_Hs02_00365054 predicted 1049
9 SASI_Hs02_00365055 predicted 1153
10 SASI_Hs02_00365056 predicted 1338
11 SASI_Hs01_00112835 predicted 390
12 SASI_Hs01_00112836 predicted 391
13 SASI_Hs01_00112837 predicted 327
14 SASI_Hs01_00112838 predicted 318
15 SASI_Hs01_00112840 predicted 404
16 SASI_Hs01_00112841 predicted 404
17 SASI_Hs01_00112842 predicted 390
18 SASI_Hs01_00112843 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117395 predicted 390
2 SASI_Rn01_00117398 predicted 386
3 SASI_Rn01_00117399 predicted 365
4 SASI_Rn01_00117400 predicted 421
5 SASI_Rn02_00263740 predicted 361
6 SASI_Rn01_00117401 predicted 309
7 SASI_Rn01_00117402 predicted 296
8 SASI_Rn01_00117403 predicted 406
9 SASI_Rn01_00117404 predicted 353
10 SASI_Rn02_00263741 predicted 410
11 SASI_Rn01_00117396 predicted 233
12 SASI_Rn01_00117397 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126766 predicted 218
2 SASI_Rn01_00126767 predicted 206
3 SASI_Rn01_00126768 predicted 271
4 SASI_Rn01_00126769 predicted 397
5 SASI_Rn01_00126770 predicted 389
6 SASI_Rn01_00126771 predicted 393
7 SASI_Rn01_00126772 predicted 228
8 SASI_Rn01_00126773 predicted 389
9 SASI_Rn01_00126774 predicted 266
10 SASI_Rn01_00126775 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025984 predicted 1098
2 SASI_Mm01_00025985 predicted 877
3 SASI_Mm01_00025986 predicted 782
4 SASI_Mm01_00025987 predicted 242
5 SASI_Mm01_00025988 predicted 874
6 SASI_Mm01_00025989 predicted 295
7 SASI_Mm01_00025990 predicted 989
8 SASI_Mm01_00025991 predicted 443
9 SASI_Mm01_00025993 predicted 382
10 SASI_Mm02_00323653 predicted 1106
11 SASI_Mm01_00025992 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016862
VALIDATED
VTI1A MISSION shRNA Bacterial Glycerol Stock
vesicle transport through interaction with t-SNAREs 1A
Mouse
22 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-700s21c1
Sequence:CCGGCATCGTGGTCATCGCCATCCTCTCGAGAGGATGGCGATGACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-672s21c1
Sequence:CCGGACCGTATCCTGCTCGTCATCTCTCGAGAGATGACGAGCAGGATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-736s21c1
Sequence:CCGGTTTCGTCAAAGGACACTGATGCTCGAGCATCAGTGTCCTTTGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-265s21c1
Sequence:CCGGGGATTTGGAAGTTCGAGAAATCTCGAGATTTCTCGAACTTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-322s21c1
Sequence:CCGGGAGAAGCTACAAGCAAGAAATCTCGAGATTTCTTGCTTGTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-377s21c1
Sequence:CCGGATCGCCTACAGTGACGAAGTACTCGAGTACTTCGTCACTGTAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-784s21c1
Sequence:CCGGTCTTGGCTTGTTCCGAGTAATCTCGAGATTACTCGGAACAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-291s21c1
Sequence:CCGGCCCAAAGTCGAGGAATGTATACTCGAGTATACATTCCTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-624s21c1
Sequence:CCGGGGAAGAGCTCTCGGATTCTGACTCGAGTCAGAATCCGAGAGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-476s21c1
Sequence:CCGGGAAAGGTCGTCTCGGAGACTACTCGAGTAGTCTCCGAGACGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-442s21c1
Sequence:CCGGGAGGGCACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-816s21c1
Sequence:CCGGGGTCACATGAATCATTCTTTCCTCGAGGAAAGAATGATTCATGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-647s21c1
Sequence:CCGGGGGATGCTGCGAAGAATCATCCTCGAGGATGATTCTTCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-886s21c1
Sequence:CCGGGCTGAGTGCAGAGAGTGTAAACTCGAGTTTACACTCTCTGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-154s21c1
Sequence:CCGGGATCACCAGCAAGATTGCAAGCTCGAGCTTGCAATCTTGCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-598s21c1
Sequence:CCGGACTCCGGGACGCAGATGCAAACTCGAGTTTGCATCTGCGTCCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-953s21c1
Sequence:CCGGGGTTGGTCTTTGCCCAGATTTCTCGAGAAATCTGGGCAAAGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016862.2-1539s1c1
Sequence:CCGGGCGTGAGAATTGGCACAGAATCTCGAGATTCTGTGCCAATTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-652s1c1
Sequence:CCGGGCTGCGAAGAATCATCCAGAACTCGAGTTCTGGATGATTCTTCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-257s1c1
Sequence:CCGGGAACAGATGGATTTGGAAGTTCTCGAGAACTTCCAAATCCATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-555s1c1
Sequence:CCGGACCTGAGTCATGACAGAGAAACTCGAGTTTCTCTGTCATGACTCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-149s1c1
Sequence:CCGGGCTGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016862
VALIDATED
VTI1A MISSION shRNA shRNA Plasmid DNA
vesicle transport through interaction with t-SNAREs 1A
Mouse
22 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-700s21c1
Sequence:CCGGCATCGTGGTCATCGCCATCCTCTCGAGAGGATGGCGATGACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-672s21c1
Sequence:CCGGACCGTATCCTGCTCGTCATCTCTCGAGAGATGACGAGCAGGATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-736s21c1
Sequence:CCGGTTTCGTCAAAGGACACTGATGCTCGAGCATCAGTGTCCTTTGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-265s21c1
Sequence:CCGGGGATTTGGAAGTTCGAGAAATCTCGAGATTTCTCGAACTTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-322s21c1
Sequence:CCGGGAGAAGCTACAAGCAAGAAATCTCGAGATTTCTTGCTTGTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-377s21c1
Sequence:CCGGATCGCCTACAGTGACGAAGTACTCGAGTACTTCGTCACTGTAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-784s21c1
Sequence:CCGGTCTTGGCTTGTTCCGAGTAATCTCGAGATTACTCGGAACAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-291s21c1
Sequence:CCGGCCCAAAGTCGAGGAATGTATACTCGAGTATACATTCCTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-624s21c1
Sequence:CCGGGGAAGAGCTCTCGGATTCTGACTCGAGTCAGAATCCGAGAGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-476s21c1
Sequence:CCGGGAAAGGTCGTCTCGGAGACTACTCGAGTAGTCTCCGAGACGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-442s21c1
Sequence:CCGGGAGGGCACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-816s21c1
Sequence:CCGGGGTCACATGAATCATTCTTTCCTCGAGGAAAGAATGATTCATGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-647s21c1
Sequence:CCGGGGGATGCTGCGAAGAATCATCCTCGAGGATGATTCTTCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-886s21c1
Sequence:CCGGGCTGAGTGCAGAGAGTGTAAACTCGAGTTTACACTCTCTGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-154s21c1
Sequence:CCGGGATCACCAGCAAGATTGCAAGCTCGAGCTTGCAATCTTGCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-598s21c1
Sequence:CCGGACTCCGGGACGCAGATGCAAACTCGAGTTTGCATCTGCGTCCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-953s21c1
Sequence:CCGGGGTTGGTCTTTGCCCAGATTTCTCGAGAAATCTGGGCAAAGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016862.2-1539s1c1
Sequence:CCGGGCGTGAGAATTGGCACAGAATCTCGAGATTCTGTGCCAATTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-652s1c1
Sequence:CCGGGCTGCGAAGAATCATCCAGAACTCGAGTTCTGGATGATTCTTCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-257s1c1
Sequence:CCGGGAACAGATGGATTTGGAAGTTCTCGAGAACTTCCAAATCCATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-555s1c1
Sequence:CCGGACCTGAGTCATGACAGAGAAACTCGAGTTTCTCTGTCATGACTCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-149s1c1
Sequence:CCGGGCTGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016862
VALIDATED
VTI1A MISSION shRNA Lentiviral Transduction Particles
vesicle transport through interaction with t-SNAREs 1A
Mouse
22 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-700s21c1
Sequence:CCGGCATCGTGGTCATCGCCATCCTCTCGAGAGGATGGCGATGACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-672s21c1
Sequence:CCGGACCGTATCCTGCTCGTCATCTCTCGAGAGATGACGAGCAGGATACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-736s21c1
Sequence:CCGGTTTCGTCAAAGGACACTGATGCTCGAGCATCAGTGTCCTTTGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-265s21c1
Sequence:CCGGGGATTTGGAAGTTCGAGAAATCTCGAGATTTCTCGAACTTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-322s21c1
Sequence:CCGGGAGAAGCTACAAGCAAGAAATCTCGAGATTTCTTGCTTGTAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-377s21c1
Sequence:CCGGATCGCCTACAGTGACGAAGTACTCGAGTACTTCGTCACTGTAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-784s21c1
Sequence:CCGGTCTTGGCTTGTTCCGAGTAATCTCGAGATTACTCGGAACAAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016862.3-291s21c1
Sequence:CCGGCCCAAAGTCGAGGAATGTATACTCGAGTATACATTCCTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-624s21c1
Sequence:CCGGGGAAGAGCTCTCGGATTCTGACTCGAGTCAGAATCCGAGAGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-476s21c1
Sequence:CCGGGAAAGGTCGTCTCGGAGACTACTCGAGTAGTCTCCGAGACGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-442s21c1
Sequence:CCGGGAGGGCACATCTGCTGGATAACTCGAGTTATCCAGCAGATGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-816s21c1
Sequence:CCGGGGTCACATGAATCATTCTTTCCTCGAGGAAAGAATGATTCATGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-647s21c1
Sequence:CCGGGGGATGCTGCGAAGAATCATCCTCGAGGATGATTCTTCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-886s21c1
Sequence:CCGGGCTGAGTGCAGAGAGTGTAAACTCGAGTTTACACTCTCTGCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-154s21c1
Sequence:CCGGGATCACCAGCAAGATTGCAAGCTCGAGCTTGCAATCTTGCTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016862.3-598s21c1
Sequence:CCGGACTCCGGGACGCAGATGCAAACTCGAGTTTGCATCTGCGTCCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016862.3-953s21c1
Sequence:CCGGGGTTGGTCTTTGCCCAGATTTCTCGAGAAATCTGGGCAAAGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016862.2-1539s1c1
Sequence:CCGGGCGTGAGAATTGGCACAGAATCTCGAGATTCTGTGCCAATTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-652s1c1
Sequence:CCGGGCTGCGAAGAATCATCCAGAACTCGAGTTCTGGATGATTCTTCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-257s1c1
Sequence:CCGGGAACAGATGGATTTGGAAGTTCTCGAGAACTTCCAAATCCATCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-555s1c1
Sequence:CCGGACCTGAGTCATGACAGAGAAACTCGAGTTTCTCTGTCATGACTCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016862.2-149s1c1
Sequence:CCGGGCTGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145206
VALIDATED
VTI1A MISSION shRNA Bacterial Glycerol Stock
vesicle transport through interaction with t-SNAREs 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-769s21c1
Sequence:CCGGACTAGAGGCTGGATACCAAATCTCGAGATTTGGTATCCAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-2817s21c1
Sequence:CCGGCACGAATAGTCATCGAGTATTCTCGAGAATACTCGATGACTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-853s21c1
Sequence:CCGGGATACAGCGAGCACGTGAAAGCTCGAGCTTTCACGTGCTCGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-718s21c1
Sequence:CCGGGAGGGCACATCTGCTCGATAACTCGAGTTATCGAGCAGATGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-877s21c1
Sequence:CCGGTCGGGAAACAGATGCTAATTTCTCGAGAAATTAGCATCTGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-520s1c1
Sequence:CCGGGATACCAAATAGCAGTGGAAACTCGAGTTTCCACTGCTATTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-343s1c1
Sequence:CCGGGCTACAAACAAGAAATGGGAACTCGAGTTCCCATTTCTTGTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-237s1c1
Sequence:CCGGGTGGAGAAACAGCTTGAAGAACTCGAGTTCTTCAAGCTGTTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-165s1c1
Sequence:CCGGGCAGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_145206.1-542s1c1
Sequence:CCGGCGAGCAAATTGGTCAGGAGATCTCGAGATCTCCTGACCAATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145206
VALIDATED
VTI1A MISSION shRNA shRNA Plasmid DNA
vesicle transport through interaction with t-SNAREs 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-769s21c1
Sequence:CCGGACTAGAGGCTGGATACCAAATCTCGAGATTTGGTATCCAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-2817s21c1
Sequence:CCGGCACGAATAGTCATCGAGTATTCTCGAGAATACTCGATGACTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-853s21c1
Sequence:CCGGGATACAGCGAGCACGTGAAAGCTCGAGCTTTCACGTGCTCGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-718s21c1
Sequence:CCGGGAGGGCACATCTGCTCGATAACTCGAGTTATCGAGCAGATGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-877s21c1
Sequence:CCGGTCGGGAAACAGATGCTAATTTCTCGAGAAATTAGCATCTGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-520s1c1
Sequence:CCGGGATACCAAATAGCAGTGGAAACTCGAGTTTCCACTGCTATTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-343s1c1
Sequence:CCGGGCTACAAACAAGAAATGGGAACTCGAGTTCCCATTTCTTGTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-237s1c1
Sequence:CCGGGTGGAGAAACAGCTTGAAGAACTCGAGTTCTTCAAGCTGTTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-165s1c1
Sequence:CCGGGCAGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_145206.1-542s1c1
Sequence:CCGGCGAGCAAATTGGTCAGGAGATCTCGAGATCTCCTGACCAATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145206
VALIDATED
VTI1A MISSION shRNA Lentiviral Transduction Particles
vesicle transport through interaction with t-SNAREs 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-769s21c1
Sequence:CCGGACTAGAGGCTGGATACCAAATCTCGAGATTTGGTATCCAGCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-2817s21c1
Sequence:CCGGCACGAATAGTCATCGAGTATTCTCGAGAATACTCGATGACTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145206.2-853s21c1
Sequence:CCGGGATACAGCGAGCACGTGAAAGCTCGAGCTTTCACGTGCTCGCTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-718s21c1
Sequence:CCGGGAGGGCACATCTGCTCGATAACTCGAGTTATCGAGCAGATGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145206.2-877s21c1
Sequence:CCGGTCGGGAAACAGATGCTAATTTCTCGAGAAATTAGCATCTGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-520s1c1
Sequence:CCGGGATACCAAATAGCAGTGGAAACTCGAGTTTCCACTGCTATTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145206.1-343s1c1
Sequence:CCGGGCTACAAACAAGAAATGGGAACTCGAGTTCCCATTTCTTGTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-237s1c1
Sequence:CCGGGTGGAGAAACAGCTTGAAGAACTCGAGTTCTTCAAGCTGTTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145206.1-165s1c1
Sequence:CCGGGCAGAGATCACCAGCAAGATTCTCGAGAATCTTGCTGGTGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_145206.1-542s1c1
Sequence:CCGGCGAGCAAATTGGTCAGGAGATCTCGAGATCTCCTGACCAATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks