EMAIL THIS PAGE TO A FRIEND

VTI1B

vesicle transport through interaction with t-SNAREs 1B

Synonyms: VTI1 VTI1-LIKE VTI1L VTI2 v-SNARE vti1-rp1
UniProtKB ID: Q9UEU0, O43547, Q96J28
Gene ID:
Mouse(53612) vesicle transport through interaction with t-SNAREs 1B
Rat(100359512) vesicle transport through interaction with t-SNAREs 1B
cow(780809) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
sheep(101114615) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
domestic guinea pig(100736219) vesicle transport through interaction with t-SNAREs 1B
naked mole-rat(101717467) vesicle transport through interaction with t-SNAREs 1B
Thale Cress(839208) vesicle transport v-SNARE 12
chicken(423273) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
Zebrafish(394011) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
domestic cat(101092692) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
dog(480365) vesicle transport through interaction with t-SNAREs homolog 1B (yeast)
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006370 Rosetta Predictions human pricing
NM_016800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046975 predicted 671
2 SASI_Hs01_00046976 predicted 615
3 SASI_Hs01_00046977 predicted 711
4 SASI_Hs01_00046978 predicted 865
5 SASI_Hs01_00046979 predicted 908
6 SASI_Hs01_00046980 predicted 590
7 SASI_Hs01_00046981 predicted 781
8 SASI_Hs01_00046982 predicted 858
9 SASI_Hs01_00046983 predicted 860
10 SASI_Hs01_00046984 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072354 predicted 582
2 SASI_Mm01_00072356 predicted 436
3 SASI_Mm01_00072357 predicted 518
4 SASI_Mm01_00072358 predicted 622
5 SASI_Mm01_00072359 predicted 566
6 SASI_Mm01_00072360 predicted 580
7 SASI_Mm02_00323589 predicted 584
8 SASI_Mm01_00072361 predicted 407
9 SASI_Mm01_00072362 predicted 301
10 SASI_Mm01_00072363 predicted 389
11 SASI_Mm01_00072355 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006370
VALIDATED
VTI1B MISSION shRNA Bacterial Glycerol Stock
vesicle transport through interaction with t-SNAREs 1B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-739s1c1
Sequence:CCGGGCAGGGCACTGAAAGCCTGAACTCGAGTTCAGGCTTTCAGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-1006s1c1
Sequence:CCGGCCTGGTTTACTACAAATTCTTCTCGAGAAGAATTTGTAGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-463s1c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-663s1c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-958s1c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-580s21c1
Sequence:GTACCGGATGGAGGAGGAGCTACGTTATCTCGAGATAACGTAGCTCCTCCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-833s21c1
Sequence:GTACCGGTTGAACGTTCTCATCGGATTGCTCGAGCAATCCGATGAGAACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-869s21c1
Sequence:GTACCGGAGATTGGCTCAGAAATCATAGCTCGAGCTATGATTTCTGAGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-1014s21c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-719s21c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-519s21c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-970s21c1
Sequence:CCGGCGGAAGATTCTCCGTTCAATGCTCGAGCATTGAACGGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-646s21c1
Sequence:CCGGTACCGGAAGGACCTTGCTAAACTCGAGTTTAGCAAGGTCCTTCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006370
VALIDATED
VTI1B MISSION shRNA shRNA Plasmid DNA
vesicle transport through interaction with t-SNAREs 1B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-739s1c1
Sequence:CCGGGCAGGGCACTGAAAGCCTGAACTCGAGTTCAGGCTTTCAGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-1006s1c1
Sequence:CCGGCCTGGTTTACTACAAATTCTTCTCGAGAAGAATTTGTAGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-463s1c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-663s1c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-958s1c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-580s21c1
Sequence:GTACCGGATGGAGGAGGAGCTACGTTATCTCGAGATAACGTAGCTCCTCCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-833s21c1
Sequence:GTACCGGTTGAACGTTCTCATCGGATTGCTCGAGCAATCCGATGAGAACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-869s21c1
Sequence:GTACCGGAGATTGGCTCAGAAATCATAGCTCGAGCTATGATTTCTGAGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-1014s21c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-719s21c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-519s21c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-970s21c1
Sequence:CCGGCGGAAGATTCTCCGTTCAATGCTCGAGCATTGAACGGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-646s21c1
Sequence:CCGGTACCGGAAGGACCTTGCTAAACTCGAGTTTAGCAAGGTCCTTCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006370
VALIDATED
VTI1B MISSION shRNA Lentiviral Transduction Particles
vesicle transport through interaction with t-SNAREs 1B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-739s1c1
Sequence:CCGGGCAGGGCACTGAAAGCCTGAACTCGAGTTCAGGCTTTCAGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006370.1-1006s1c1
Sequence:CCGGCCTGGTTTACTACAAATTCTTCTCGAGAAGAATTTGTAGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-463s1c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-663s1c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006370.1-958s1c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-580s21c1
Sequence:GTACCGGATGGAGGAGGAGCTACGTTATCTCGAGATAACGTAGCTCCTCCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-833s21c1
Sequence:GTACCGGTTGAACGTTCTCATCGGATTGCTCGAGCAATCCGATGAGAACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006370.2-869s21c1
Sequence:GTACCGGAGATTGGCTCAGAAATCATAGCTCGAGCTATGATTTCTGAGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-1014s21c1
Sequence:CCGGGCTGCTGCTTTCCATTATCATCTCGAGATGATAATGGAAAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-719s21c1
Sequence:CCGGGAGACATGAAATATGGCATATCTCGAGATATGCCATATTTCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-519s21c1
Sequence:CCGGGAAGAAATTGATCAGGGATTTCTCGAGAAATCCCTGATCAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-970s21c1
Sequence:CCGGCGGAAGATTCTCCGTTCAATGCTCGAGCATTGAACGGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006370.2-646s21c1
Sequence:CCGGTACCGGAAGGACCTTGCTAAACTCGAGTTTAGCAAGGTCCTTCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016800
VALIDATED
VTI1B MISSION shRNA Bacterial Glycerol Stock
vesicle transport through interaction with t-SNAREs 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-627s1c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-380s1c1
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-500s1c1
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-281s1c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-717s1c1
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-500s21c2
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-717s21c2
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-380s21c3
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-281s21c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-627s21c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016800
VALIDATED
VTI1B MISSION shRNA shRNA Plasmid DNA
vesicle transport through interaction with t-SNAREs 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-627s1c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-380s1c1
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-500s1c1
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-281s1c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-717s1c1
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-500s21c2
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-717s21c2
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-380s21c3
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-281s21c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-627s21c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016800
VALIDATED
VTI1B MISSION shRNA Lentiviral Transduction Particles
vesicle transport through interaction with t-SNAREs 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-627s1c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-380s1c1
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-500s1c1
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-281s1c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016800.2-717s1c1
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-500s21c2
Sequence:CCGGCTCATCGGATTGCCACAGAAACTCGAGTTTCTGTGGCAATCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-717s21c2
Sequence:CCGGCGGTCTGGTGTATTACAAATTCTCGAGAATTTGTAATACACCAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-380s21c3
Sequence:CCGGACCTGAAGTATGGCACGTATACTCGAGTATACGTGCCATACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-281s21c1
Sequence:CCGGCCATGATGTCTAAGCTGAGAACTCGAGTTCTCAGCTTAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016800.2-627s21c1
Sequence:CCGGCCGGAAGATTCTTCGCTCAATCTCGAGATTGAGCGAAGAATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks