EMAIL THIS PAGE TO A FRIEND

VTN

vitronectin

Synonyms: V75 VN VNT
UniProtKB ID: P04004, B2R7G0, P01141, Q9BSH7
Gene ID:
Human(7448) Summary: The protein encoded by this gene is a member of the pexin family. It is found in serum and tissues and promotes cell adhesion and spreading, inhibits the membrane-damaging effect of the terminal cytolytic complement pathway, and binds to several serpin serine protease inhibitors. It is a secreted protein and exists in either a single chain form or a clipped, two chain form held together by a disulfide bond. [provided by RefSeq, Jul 2008]
Mouse(22370) vitronectin
Rat(29169) vitronectin
chicken(395935) vitronectin
dog(480621) vitronectin
cow(507525) vitronectin
Goat(100861216) vitronectin
sheep(101119231) vitronectin
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G5646 Gly-Arg-Gly-Asp-Thr-Pro ≥97% (HPLC) human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0559 AQUA Peptide (CM-Cys)TEGFNVD[K] human pricing
AQ0560 AQUA Peptide VDTVDPPYP[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000638 Rosetta Predictions human pricing
NM_019156 Rosetta Predictions rat pricing
NM_011707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302989 predicted 230
2 SASI_Hs01_00115248 predicted 800
3 SASI_Hs01_00115249 predicted 373
4 SASI_Hs01_00115250 predicted 400
5 SASI_Hs01_00115252 predicted 555
6 SASI_Hs01_00115253 predicted 564
7 SASI_Hs01_00115254 predicted 304
8 SASI_Hs01_00115255 predicted 863
9 SASI_Hs02_00302990 predicted 768
10 SASI_Hs01_00115257 predicted 678
11 SASI_Hs01_00115251 predicted 1389
12 SASI_Hs01_00115256 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073986 predicted 1367
2 SASI_Rn02_00261932 predicted 360
3 SASI_Rn01_00073987 predicted 1114
4 SASI_Rn01_00073988 predicted 564
5 SASI_Rn02_00261933 predicted 785
6 SASI_Rn01_00073989 predicted 856
7 SASI_Rn01_00073990 predicted 604
8 SASI_Rn01_00073992 predicted 1175
9 SASI_Rn02_00261934 predicted 384
10 SASI_Rn02_00261935 predicted 1276
11 SASI_Rn01_00073991 predicted 363
12 SASI_Rn01_00073993 predicted 317
13 SASI_Rn01_00073994 predicted 331
14 SASI_Rn01_00073995 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031023 predicted 1302
2 SASI_Mm01_00031024 predicted 1098
3 SASI_Mm01_00031025 predicted 270
4 SASI_Mm01_00031026 predicted 1256
5 SASI_Mm01_00031027 predicted 1300
6 SASI_Mm01_00031028 predicted 890
7 SASI_Mm01_00031029 predicted 531
8 SASI_Mm01_00031030 predicted 1166
9 SASI_Mm01_00031031 predicted 1166
10 SASI_Mm02_00321270 predicted 892
11 SASI_Mm01_00031032 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000638
VTN MISSION shRNA Bacterial Glycerol Stock
vitronectin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-267s21c1
Sequence:CCGGTGTGACGAGCTCTGCTCTTACCTCGAGGTAAGAGCAGAGCTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-820s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-292s21c1
Sequence:CCGGAGAGCTGCTGCACAGACTATACTCGAGTATAGTCTGTGCAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1213s1c1
Sequence:CCGGCCGAAATATCTCTGACGGCTTCTCGAGAAGCCGTCAGAGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1029s1c1
Sequence:CCGGACTGCTATGAACTGGACGAAACTCGAGTTTCGTCCAGTTCATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1734s1c1
Sequence:CCGGCCAACAACTATGATGACTACACTCGAGTGTAGTCATCATAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1817s1c1
Sequence:CCGGGACAAGTACTACCGAGTCAATCTCGAGATTGACTCGGTAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-707s1c1
Sequence:CCGGGAGGATGAGTACACGGTCTATCTCGAGATAGACCGTGTACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000638
VTN MISSION shRNA shRNA Plasmid DNA
vitronectin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-267s21c1
Sequence:CCGGTGTGACGAGCTCTGCTCTTACCTCGAGGTAAGAGCAGAGCTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-820s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-292s21c1
Sequence:CCGGAGAGCTGCTGCACAGACTATACTCGAGTATAGTCTGTGCAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1213s1c1
Sequence:CCGGCCGAAATATCTCTGACGGCTTCTCGAGAAGCCGTCAGAGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1029s1c1
Sequence:CCGGACTGCTATGAACTGGACGAAACTCGAGTTTCGTCCAGTTCATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1734s1c1
Sequence:CCGGCCAACAACTATGATGACTACACTCGAGTGTAGTCATCATAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1817s1c1
Sequence:CCGGGACAAGTACTACCGAGTCAATCTCGAGATTGACTCGGTAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-707s1c1
Sequence:CCGGGAGGATGAGTACACGGTCTATCTCGAGATAGACCGTGTACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000638
VTN MISSION shRNA Lentiviral Transduction Particles
vitronectin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-267s21c1
Sequence:CCGGTGTGACGAGCTCTGCTCTTACCTCGAGGTAAGAGCAGAGCTCGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-820s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000638.3-292s21c1
Sequence:CCGGAGAGCTGCTGCACAGACTATACTCGAGTATAGTCTGTGCAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1213s1c1
Sequence:CCGGCCGAAATATCTCTGACGGCTTCTCGAGAAGCCGTCAGAGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1029s1c1
Sequence:CCGGACTGCTATGAACTGGACGAAACTCGAGTTTCGTCCAGTTCATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1734s1c1
Sequence:CCGGCCAACAACTATGATGACTACACTCGAGTGTAGTCATCATAGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-1817s1c1
Sequence:CCGGGACAAGTACTACCGAGTCAATCTCGAGATTGACTCGGTAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000638.2-707s1c1
Sequence:CCGGGAGGATGAGTACACGGTCTATCTCGAGATAGACCGTGTACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011707
VTN MISSION shRNA Bacterial Glycerol Stock
vitronectin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-304s21c1
Sequence:CCGGTGGAGGAGCCCAAGAACAATACTCGAGTATTGTTCTTGGGCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-184s21c1
Sequence:CCGGACGAGCTTTGCACTTACTATCCTCGAGGATAGTAAGTGCAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-1121s21c1
Sequence:CCGGCTACGTCACTGGCTCCTTATCCTCGAGGATAAGGAGCCAGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-891s21c1
Sequence:CCGGCAGTACTGGGAGTACGAATTTCTCGAGAAATTCGTACTCCCAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-730s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1358s1c1
Sequence:CCGGGCCCATTCAGAGCGTCTATTTCTCGAGAAATAGACGCTCTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1244s1c1
Sequence:CCGGCCGTCGTTCATCACGTTCAATCTCGAGATTGAACGTGATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-276s1c1
Sequence:CCGGGAGGATGATTATTGGAGCTATCTCGAGATAGCTCCAATAATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1298s1c1
Sequence:CCGGGCTAGGAACCTACAACAACTACTCGAGTAGTTGTTGTAGGTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1299s1c1
Sequence:CCGGCTAGGAACCTACAACAACTATCTCGAGATAGTTGTTGTAGGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011707
VTN MISSION shRNA shRNA Plasmid DNA
vitronectin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-304s21c1
Sequence:CCGGTGGAGGAGCCCAAGAACAATACTCGAGTATTGTTCTTGGGCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-184s21c1
Sequence:CCGGACGAGCTTTGCACTTACTATCCTCGAGGATAGTAAGTGCAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-1121s21c1
Sequence:CCGGCTACGTCACTGGCTCCTTATCCTCGAGGATAAGGAGCCAGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-891s21c1
Sequence:CCGGCAGTACTGGGAGTACGAATTTCTCGAGAAATTCGTACTCCCAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-730s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1358s1c1
Sequence:CCGGGCCCATTCAGAGCGTCTATTTCTCGAGAAATAGACGCTCTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1244s1c1
Sequence:CCGGCCGTCGTTCATCACGTTCAATCTCGAGATTGAACGTGATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-276s1c1
Sequence:CCGGGAGGATGATTATTGGAGCTATCTCGAGATAGCTCCAATAATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1298s1c1
Sequence:CCGGGCTAGGAACCTACAACAACTACTCGAGTAGTTGTTGTAGGTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1299s1c1
Sequence:CCGGCTAGGAACCTACAACAACTATCTCGAGATAGTTGTTGTAGGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011707
VTN MISSION shRNA Lentiviral Transduction Particles
vitronectin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-304s21c1
Sequence:CCGGTGGAGGAGCCCAAGAACAATACTCGAGTATTGTTCTTGGGCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-184s21c1
Sequence:CCGGACGAGCTTTGCACTTACTATCCTCGAGGATAGTAAGTGCAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-1121s21c1
Sequence:CCGGCTACGTCACTGGCTCCTTATCCTCGAGGATAAGGAGCCAGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-891s21c1
Sequence:CCGGCAGTACTGGGAGTACGAATTTCTCGAGAAATTCGTACTCCCAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011707.1-730s21c1
Sequence:CCGGGTAGTCAGTACTGGCGCTTTGCTCGAGCAAAGCGCCAGTACTGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1358s1c1
Sequence:CCGGGCCCATTCAGAGCGTCTATTTCTCGAGAAATAGACGCTCTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1244s1c1
Sequence:CCGGCCGTCGTTCATCACGTTCAATCTCGAGATTGAACGTGATGAACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-276s1c1
Sequence:CCGGGAGGATGATTATTGGAGCTATCTCGAGATAGCTCCAATAATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1298s1c1
Sequence:CCGGGCTAGGAACCTACAACAACTACTCGAGTAGTTGTTGTAGGTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011707.1-1299s1c1
Sequence:CCGGCTAGGAACCTACAACAACTATCTCGAGATAGTTGTTGTAGGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks