EMAIL THIS PAGE TO A FRIEND

VWA1

von Willebrand factor A domain containing 1

Synonyms: WARP
UniProtKB ID: Q6PCB0, A8K692, B3KUA1, E9PB53, Q7L5D7, Q9H6J5
Gene ID:
Human(64856) Summary: VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]
Mouse(246228) von Willebrand factor A domain containing 1
Rat(298683) von Willebrand factor A domain containing 1
Zebrafish(333989) von Willebrand factor A domain containing 1
chicken(419413) von Willebrand factor A domain containing 1
dog(607112) von Willebrand factor A domain containing 1
domestic cat(101086047) von Willebrand factor A domain containing 1
cow(505917) von Willebrand factor A domain containing 1
sheep(101103744) von Willebrand factor A domain containing 1
domestic guinea pig(100713784) von Willebrand factor A domain containing 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022834 Rosetta Predictions human pricing
NM_199121 Rosetta Predictions human pricing
NM_001013938 Rosetta Predictions rat pricing
NM_147776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157201 predicted 1864
2 SASI_Hs01_00157202 predicted 1927
3 SASI_Hs01_00157203 predicted 1062
4 SASI_Hs01_00157204 predicted 1987
5 SASI_Hs01_00157205 predicted 1821
6 SASI_Hs01_00157206 predicted 995
7 SASI_Hs01_00157207 predicted 1815
8 SASI_Hs01_00157208 predicted 923
9 SASI_Hs01_00157209 predicted 769
10 SASI_Hs01_00157210 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068445 predicted 1468
2 SASI_Hs01_00068446 predicted 1527
3 SASI_Hs01_00068447 predicted 662
4 SASI_Hs01_00068448 predicted 1587
5 SASI_Hs01_00068449 predicted 1425
6 SASI_Hs01_00068450 predicted 606
7 SASI_Hs01_00068451 predicted 1422
8 SASI_Hs01_00068452 predicted 532
9 SASI_Hs01_00068453 predicted 487
10 SASI_Hs01_00068454 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062383 predicted 815
2 SASI_Rn01_00062385 predicted 926
3 SASI_Rn02_00201247 predicted 325
4 SASI_Rn01_00062386 predicted 1404
5 SASI_Rn01_00062387 predicted 622
6 SASI_Rn01_00062388 predicted 1682
7 SASI_Rn01_00062389 predicted 658
8 SASI_Rn01_00062390 predicted 314
9 SASI_Rn01_00062391 predicted 1487
10 SASI_Rn01_00062392 predicted 256
11 SASI_Rn01_00062384 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133753 predicted 590
2 SASI_Mm01_00133754 predicted 779
3 SASI_Mm01_00133755 predicted 1699
4 SASI_Mm01_00133756 predicted 562
5 SASI_Mm01_00133757 predicted 1730
6 SASI_Mm01_00133758 predicted 1601
7 SASI_Mm01_00133759 predicted 1539
8 SASI_Mm01_00133761 predicted 418
9 SASI_Mm02_00342711 predicted 1588
10 SASI_Mm01_00133762 predicted 326
11 SASI_Mm01_00133760 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022834
VWA1 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000117177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022834.3-2146s1c1
Sequence:CCGGGCCACTGGGAATCAGAGGAATCTCGAGATTCCTCTGATTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-811s1c1
Sequence:CCGGCCTGCACATCATTGTCCAAGACTCGAGTCTTGGACAATGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-349s1c1
Sequence:CCGGCAGCGTCTCTCACTACGAGTTCTCGAGAACTCGTAGTGAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-776s1c1
Sequence:CCGGGCCGAGAAGCACCTGCACTTTCTCGAGAAAGTGCAGGTGCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022834
VWA1 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000117177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022834.3-2146s1c1
Sequence:CCGGGCCACTGGGAATCAGAGGAATCTCGAGATTCCTCTGATTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-811s1c1
Sequence:CCGGCCTGCACATCATTGTCCAAGACTCGAGTCTTGGACAATGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-349s1c1
Sequence:CCGGCAGCGTCTCTCACTACGAGTTCTCGAGAACTCGTAGTGAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-776s1c1
Sequence:CCGGGCCGAGAAGCACCTGCACTTTCTCGAGAAAGTGCAGGTGCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022834
VWA1 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000117177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022834.3-2146s1c1
Sequence:CCGGGCCACTGGGAATCAGAGGAATCTCGAGATTCCTCTGATTCCCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-811s1c1
Sequence:CCGGCCTGCACATCATTGTCCAAGACTCGAGTCTTGGACAATGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-349s1c1
Sequence:CCGGCAGCGTCTCTCACTACGAGTTCTCGAGAACTCGTAGTGAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022834.3-776s1c1
Sequence:CCGGGCCGAGAAGCACCTGCACTTTCTCGAGAAAGTGCAGGTGCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147776
VWA1 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147776.2-1986s1c1
Sequence:CCGGCCGCACTATGACAGATTCTAACTCGAGTTAGAATCTGTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-359s1c1
Sequence:CCGGGCACTGGCTTATGCCAAAGAACTCGAGTTCTTTGGCATAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-152s1c1
Sequence:CCGGCACTATGAGTTCTCAAGAGTTCTCGAGAACTCTTGAGAACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-596s1c1
Sequence:CCGGGTGGATGATCTTCCTATCATTCTCGAGAATGATAGGAAGATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-836s1c1
Sequence:CCGGCCGGACACAGACTATGAAGTACTCGAGTACTTCATAGTCTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1599s21c1
Sequence:CCGGGAGGTCAGGTTGAGGACATAACTCGAGTTATGTCCTCAACCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1424s21c1
Sequence:CCGGGCCTTTGACCAGCGTTAATTCCTCGAGGAATTAACGCTGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147776.4-90s21c1
Sequence:CCGGTTGAGTCTGCGGTTGGCATTGCTCGAGCAATGCCAACCGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147776
VWA1 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147776.2-1986s1c1
Sequence:CCGGCCGCACTATGACAGATTCTAACTCGAGTTAGAATCTGTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-359s1c1
Sequence:CCGGGCACTGGCTTATGCCAAAGAACTCGAGTTCTTTGGCATAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-152s1c1
Sequence:CCGGCACTATGAGTTCTCAAGAGTTCTCGAGAACTCTTGAGAACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-596s1c1
Sequence:CCGGGTGGATGATCTTCCTATCATTCTCGAGAATGATAGGAAGATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-836s1c1
Sequence:CCGGCCGGACACAGACTATGAAGTACTCGAGTACTTCATAGTCTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1599s21c1
Sequence:CCGGGAGGTCAGGTTGAGGACATAACTCGAGTTATGTCCTCAACCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1424s21c1
Sequence:CCGGGCCTTTGACCAGCGTTAATTCCTCGAGGAATTAACGCTGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147776.4-90s21c1
Sequence:CCGGTTGAGTCTGCGGTTGGCATTGCTCGAGCAATGCCAACCGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147776
VWA1 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147776.2-1986s1c1
Sequence:CCGGCCGCACTATGACAGATTCTAACTCGAGTTAGAATCTGTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-359s1c1
Sequence:CCGGGCACTGGCTTATGCCAAAGAACTCGAGTTCTTTGGCATAAGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-152s1c1
Sequence:CCGGCACTATGAGTTCTCAAGAGTTCTCGAGAACTCTTGAGAACTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-596s1c1
Sequence:CCGGGTGGATGATCTTCCTATCATTCTCGAGAATGATAGGAAGATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147776.2-836s1c1
Sequence:CCGGCCGGACACAGACTATGAAGTACTCGAGTACTTCATAGTCTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1599s21c1
Sequence:CCGGGAGGTCAGGTTGAGGACATAACTCGAGTTATGTCCTCAACCTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147776.4-1424s21c1
Sequence:CCGGGCCTTTGACCAGCGTTAATTCCTCGAGGAATTAACGCTGGTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147776.4-90s21c1
Sequence:CCGGTTGAGTCTGCGGTTGGCATTGCTCGAGCAATGCCAACCGCAGACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks