EMAIL THIS PAGE TO A FRIEND

VWA2

von Willebrand factor A domain containing 2

Synonyms: AMACO CCSP-2 NET42
Gene ID:
Human(340706) Summary: This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Mouse(240675) von Willebrand factor A domain containing 2
Rat(307988) von Willebrand factor A domain containing 2
domestic guinea pig(100714046) von Willebrand factor A domain containing 2
Domestic Rabbit(100346818) von Willebrand factor A domain containing 2
naked mole-rat(101705083) von Willebrand factor A domain containing 2
cow(530237) von Willebrand factor A domain containing 2
sheep(101118836) von Willebrand factor A domain containing 2
Zebrafish(567428) von Willebrand factor A domain containing 2
chicken(423907) von Willebrand factor A domain containing 2
dog(477827) von Willebrand factor A domain containing 2
Horse(100068127) von Willebrand factor A domain containing 2
domestic cat(101081676) von Willebrand factor A domain containing 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198496 Rosetta Predictions human pricing
XM_217642 Rosetta Predictions rat pricing
XR_008134 Rosetta Predictions rat pricing
NM_172840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113537 predicted 463
2 SASI_Hs02_00372065 predicted 414
3 SASI_Hs01_00113538 predicted 1810
4 SASI_Hs01_00113539 predicted 652
5 SASI_Hs01_00113540 predicted 1962
6 SASI_Hs01_00113541 predicted 703
7 SASI_Hs01_00113542 predicted 592
8 SASI_Hs01_00113543 predicted 2095
9 SASI_Hs01_00113544 predicted 1304
10 SASI_Hs01_00113546 predicted 2003
11 SASI_Hs01_00113545 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154141 predicted 2009
2 SASI_Rn01_00154142 predicted 1328
3 SASI_Rn01_00154143 predicted 912
4 SASI_Rn01_00154144 predicted 1961
5 SASI_Rn01_00154145 predicted 1060
6 SASI_Rn01_00154146 predicted 1491
7 SASI_Rn01_00154147 predicted 1951
8 SASI_Rn01_00154148 predicted 1261
9 SASI_Rn01_00154149 predicted 1565
10 SASI_Rn01_00154150 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164858 predicted 2095
2 SASI_Rn01_00164859 predicted 1411
3 SASI_Rn01_00164860 predicted 1001
4 SASI_Rn02_00416301 predicted 1625
5 SASI_Rn02_00416302 predicted 857
6 SASI_Rn01_00164861 predicted 2051
7 SASI_Rn01_00164863 predicted 1573
8 SASI_Rn01_00164864 predicted 2036
9 SASI_Rn01_00164865 predicted 1345
10 SASI_Rn01_00164866 predicted 1653
11 SASI_Rn01_00164862 predicted 1155
12 SASI_Rn01_00164867 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049402 predicted 1321
2 SASI_Mm01_00049403 predicted 2606
3 SASI_Mm01_00049404 predicted 2620
4 SASI_Mm01_00049405 predicted 1209
5 SASI_Mm01_00049406 predicted 1845
6 SASI_Mm01_00049407 predicted 1830
7 SASI_Mm01_00049408 predicted 1811
8 SASI_Mm01_00049409 predicted 948
9 SASI_Mm01_00049410 predicted 2230
10 SASI_Mm01_00049411 predicted 1385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172840
VWA2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2690s21c1
Sequence:CCGGGAGGTAAGCTGCCTGTCATTTCTCGAGAAATGACAGGCAGCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2981s21c1
Sequence:CCGGTTTGACCAATTACTCAGTTTGCTCGAGCAAACTGAGTAATTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172840.2-1799s21c1
Sequence:CCGGACGTGAGAACTTTGCCCAAATCTCGAGATTTGGGCAAAGTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2643s21c1
Sequence:CCGGCGACTACTGCGTCAGCATTTACTCGAGTAAATGCTGACGCAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172840.2-3186s1c1
Sequence:CCGGCCCAGGAGGTTTGCTTTCAAACTCGAGTTTGAAAGCAAACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-2506s1c1
Sequence:CCGGCCAAGCATCTTAGAATCGGAACTCGAGTTCCGATTCTAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1099s1c1
Sequence:CCGGGCATTCCAGAAGGTGTGGATACTCGAGTATCCACACCTTCTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1848s1c1
Sequence:CCGGCGGTTTGATGTGAATCCTGATCTCGAGATCAGGATTCACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1323s1c1
Sequence:CCGGGCCAGTTATGGCAGGAATCTACTCGAGTAGATTCCTGCCATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172840
VWA2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2690s21c1
Sequence:CCGGGAGGTAAGCTGCCTGTCATTTCTCGAGAAATGACAGGCAGCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2981s21c1
Sequence:CCGGTTTGACCAATTACTCAGTTTGCTCGAGCAAACTGAGTAATTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172840.2-1799s21c1
Sequence:CCGGACGTGAGAACTTTGCCCAAATCTCGAGATTTGGGCAAAGTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2643s21c1
Sequence:CCGGCGACTACTGCGTCAGCATTTACTCGAGTAAATGCTGACGCAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172840.2-3186s1c1
Sequence:CCGGCCCAGGAGGTTTGCTTTCAAACTCGAGTTTGAAAGCAAACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-2506s1c1
Sequence:CCGGCCAAGCATCTTAGAATCGGAACTCGAGTTCCGATTCTAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1099s1c1
Sequence:CCGGGCATTCCAGAAGGTGTGGATACTCGAGTATCCACACCTTCTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1848s1c1
Sequence:CCGGCGGTTTGATGTGAATCCTGATCTCGAGATCAGGATTCACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1323s1c1
Sequence:CCGGGCCAGTTATGGCAGGAATCTACTCGAGTAGATTCCTGCCATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172840
VWA2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2690s21c1
Sequence:CCGGGAGGTAAGCTGCCTGTCATTTCTCGAGAAATGACAGGCAGCTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2981s21c1
Sequence:CCGGTTTGACCAATTACTCAGTTTGCTCGAGCAAACTGAGTAATTGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172840.2-1799s21c1
Sequence:CCGGACGTGAGAACTTTGCCCAAATCTCGAGATTTGGGCAAAGTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172840.2-2643s21c1
Sequence:CCGGCGACTACTGCGTCAGCATTTACTCGAGTAAATGCTGACGCAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172840.2-3186s1c1
Sequence:CCGGCCCAGGAGGTTTGCTTTCAAACTCGAGTTTGAAAGCAAACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-2506s1c1
Sequence:CCGGCCAAGCATCTTAGAATCGGAACTCGAGTTCCGATTCTAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1099s1c1
Sequence:CCGGGCATTCCAGAAGGTGTGGATACTCGAGTATCCACACCTTCTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1848s1c1
Sequence:CCGGCGGTTTGATGTGAATCCTGATCTCGAGATCAGGATTCACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172840.2-1323s1c1
Sequence:CCGGGCCAGTTATGGCAGGAATCTACTCGAGTAGATTCCTGCCATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198496
VWA2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2638s21c1
Sequence:CCGGGGTACAGAAAGTTTAACTAACCTCGAGGTTAGTTAAACTTTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-707s21c1
Sequence:CCGGAGACGGAACTTGCTCTGAAATCTCGAGATTTCAGAGCAAGTTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-1410s21c1
Sequence:CCGGAGTCTTCGTGAAGCGGTTTGTCTCGAGACAAACCGCTTCACGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2729s21c1
Sequence:CCGGCAAGCTTCCTAAGGGTCTAAACTCGAGTTTAGACCCTTAGGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-667s1c1
Sequence:CCGGGCAAGAATCAAGAGGATGGTTCTCGAGAACCATCCTCTTGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-1828s1c1
Sequence:CCGGCCTCAGGATCTGTTCAACCAACTCGAGTTGGTTGAACAGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-402s1c1
Sequence:CCGGCCATGTAAGCAAAGAAACCATCTCGAGATGGTTTCTTTGCTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-2275s1c1
Sequence:CCGGGCCCAGAAGCTGAGGAACAATCTCGAGATTGTTCCTCAGCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-469s1c1
Sequence:CCGGGTGGACATCATGTTTCTGTTACTCGAGTAACAGAAACATGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198496
VWA2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2638s21c1
Sequence:CCGGGGTACAGAAAGTTTAACTAACCTCGAGGTTAGTTAAACTTTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-707s21c1
Sequence:CCGGAGACGGAACTTGCTCTGAAATCTCGAGATTTCAGAGCAAGTTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-1410s21c1
Sequence:CCGGAGTCTTCGTGAAGCGGTTTGTCTCGAGACAAACCGCTTCACGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2729s21c1
Sequence:CCGGCAAGCTTCCTAAGGGTCTAAACTCGAGTTTAGACCCTTAGGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-667s1c1
Sequence:CCGGGCAAGAATCAAGAGGATGGTTCTCGAGAACCATCCTCTTGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-1828s1c1
Sequence:CCGGCCTCAGGATCTGTTCAACCAACTCGAGTTGGTTGAACAGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-402s1c1
Sequence:CCGGCCATGTAAGCAAAGAAACCATCTCGAGATGGTTTCTTTGCTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-2275s1c1
Sequence:CCGGGCCCAGAAGCTGAGGAACAATCTCGAGATTGTTCCTCAGCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-469s1c1
Sequence:CCGGGTGGACATCATGTTTCTGTTACTCGAGTAACAGAAACATGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198496
VWA2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2638s21c1
Sequence:CCGGGGTACAGAAAGTTTAACTAACCTCGAGGTTAGTTAAACTTTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-707s21c1
Sequence:CCGGAGACGGAACTTGCTCTGAAATCTCGAGATTTCAGAGCAAGTTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198496.1-1410s21c1
Sequence:CCGGAGTCTTCGTGAAGCGGTTTGTCTCGAGACAAACCGCTTCACGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198496.1-2729s21c1
Sequence:CCGGCAAGCTTCCTAAGGGTCTAAACTCGAGTTTAGACCCTTAGGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-667s1c1
Sequence:CCGGGCAAGAATCAAGAGGATGGTTCTCGAGAACCATCCTCTTGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-1828s1c1
Sequence:CCGGCCTCAGGATCTGTTCAACCAACTCGAGTTGGTTGAACAGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-402s1c1
Sequence:CCGGCCATGTAAGCAAAGAAACCATCTCGAGATGGTTTCTTTGCTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-2275s1c1
Sequence:CCGGGCCCAGAAGCTGAGGAACAATCTCGAGATTGTTCCTCAGCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198496.1-469s1c1
Sequence:CCGGGTGGACATCATGTTTCTGTTACTCGAGTAACAGAAACATGATGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks