EMAIL THIS PAGE TO A FRIEND

VWA3A

von Willebrand factor A domain containing 3A

Gene ID:
Mouse(233813) von Willebrand factor A domain containing 3A
Rat(293449) von Willebrand factor A domain containing 3A
chicken(416616) von Willebrand factor A domain containing 3A
Horse(100058636) von Willebrand factor A domain containing 3A
domestic cat(101091746) von Willebrand factor A domain containing 3A
dog(479813) von Willebrand factor A domain containing 3A
cow(522712) von Willebrand factor A domain containing 3A
sheep(101114581) von Willebrand factor A domain containing 3A
naked mole-rat(101708579) von Willebrand factor A domain containing 3A
domestic guinea pig(100714342) von Willebrand factor A domain containing 3A
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173615 Rosetta Predictions human pricing
XM_370944 Rosetta Predictions human pricing
NM_001079885 Rosetta Predictions rat pricing
NM_177697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368483 predicted 3595
2 SASI_Hs02_00368484 predicted 2279
3 SASI_Hs02_00368485 predicted 1019
4 SASI_Hs02_00368486 predicted 1644
5 SASI_Hs02_00368487 predicted 885
6 SASI_Hs02_00368488 predicted 1010
7 SASI_Hs02_00368489 predicted 3609
8 SASI_Hs02_00368490 predicted 3574
9 SASI_Hs02_00368491 predicted 1826
10 SASI_Hs02_00368492 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288235 predicted 3372
2 SASI_Hs01_00288236 predicted 3421
3 SASI_Hs01_00288237 predicted 3383
4 SASI_Hs01_00288238 predicted 3461
5 SASI_Hs01_00288239 predicted 3418
6 SASI_Hs01_00288240 predicted 3388
7 SASI_Hs01_00288241 predicted 3408
8 SASI_Hs01_00288242 predicted 3461
9 SASI_Hs01_00288243 predicted 3380
10 SASI_Hs01_00288244 predicted 3412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208159 predicted 1895
2 SASI_Rn02_00208160 predicted 875
3 SASI_Rn02_00208161 predicted 1229
4 SASI_Rn02_00208162 predicted 396
5 SASI_Rn02_00208163 predicted 2051
6 SASI_Rn02_00208164 predicted 362
7 SASI_Rn02_00208165 predicted 798
8 SASI_Rn02_00208166 predicted 1533
9 SASI_Rn02_00208167 predicted 954
10 SASI_Rn02_00208168 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348041 predicted 535
2 SASI_Mm02_00348042 predicted 3953
3 SASI_Mm01_00152305 predicted 2471
4 SASI_Mm01_00152306 predicted 1907
5 SASI_Mm01_00152307 predicted 1631
6 SASI_Mm01_00152309 predicted 815
7 SASI_Mm01_00152310 predicted 3208
8 SASI_Mm01_00152311 predicted 2695
9 SASI_Mm01_00152312 predicted 1376
10 SASI_Mm01_00152313 predicted 1202
11 SASI_Mm01_00152304 predicted 1772
12 SASI_Mm01_00152308 predicted 1337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177697
VWA3A MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177697.2-3784s1c1
Sequence:CCGGCCTGCCATATAGCAGTCTCATCTCGAGATGAGACTGCTATATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1325s1c1
Sequence:CCGGGCAGCTACTATCCATGAGAAACTCGAGTTTCTCATGGATAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-532s1c1
Sequence:CCGGCGGCTCTCAGACAAAGGAATTCTCGAGAATTCCTTTGTCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1238s1c1
Sequence:CCGGGCCAAGAAGTTAAGTCTTTATCTCGAGATAAAGACTTAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1844s1c1
Sequence:CCGGCCTGACCAAGATGTGCACATACTCGAGTATGTGCACATCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177697
VWA3A MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177697.2-3784s1c1
Sequence:CCGGCCTGCCATATAGCAGTCTCATCTCGAGATGAGACTGCTATATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1325s1c1
Sequence:CCGGGCAGCTACTATCCATGAGAAACTCGAGTTTCTCATGGATAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-532s1c1
Sequence:CCGGCGGCTCTCAGACAAAGGAATTCTCGAGAATTCCTTTGTCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1238s1c1
Sequence:CCGGGCCAAGAAGTTAAGTCTTTATCTCGAGATAAAGACTTAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1844s1c1
Sequence:CCGGCCTGACCAAGATGTGCACATACTCGAGTATGTGCACATCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177697
VWA3A MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177697.2-3784s1c1
Sequence:CCGGCCTGCCATATAGCAGTCTCATCTCGAGATGAGACTGCTATATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1325s1c1
Sequence:CCGGGCAGCTACTATCCATGAGAAACTCGAGTTTCTCATGGATAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-532s1c1
Sequence:CCGGCGGCTCTCAGACAAAGGAATTCTCGAGAATTCCTTTGTCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1238s1c1
Sequence:CCGGGCCAAGAAGTTAAGTCTTTATCTCGAGATAAAGACTTAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177697.2-1844s1c1
Sequence:CCGGCCTGACCAAGATGTGCACATACTCGAGTATGTGCACATCTTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173615
VWA3A MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 3A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-486s21c1
Sequence:CCGGCACCCAGATCATCCGCCATTTCTCGAGAAATGGCGGATGATCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1449s21c1
Sequence:CCGGTGAGAAGGCAATGATACAATTCTCGAGAATTGTATCATTGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173615.3-3820s21c1
Sequence:CCGGATTCCCGGGTCTTAATCTAACCTCGAGGTTAGATTAAGACCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1790s21c1
Sequence:CCGGCCGTGAGTCACAACAATTTACCTCGAGGTAAATTGTTGTGACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1643s21c1
Sequence:CCGGTCGATATCTCTGCGACCAATTCTCGAGAATTGGTCGCAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173615
VWA3A MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 3A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-486s21c1
Sequence:CCGGCACCCAGATCATCCGCCATTTCTCGAGAAATGGCGGATGATCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1449s21c1
Sequence:CCGGTGAGAAGGCAATGATACAATTCTCGAGAATTGTATCATTGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173615.3-3820s21c1
Sequence:CCGGATTCCCGGGTCTTAATCTAACCTCGAGGTTAGATTAAGACCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1790s21c1
Sequence:CCGGCCGTGAGTCACAACAATTTACCTCGAGGTAAATTGTTGTGACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1643s21c1
Sequence:CCGGTCGATATCTCTGCGACCAATTCTCGAGAATTGGTCGCAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173615
VWA3A MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 3A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-486s21c1
Sequence:CCGGCACCCAGATCATCCGCCATTTCTCGAGAAATGGCGGATGATCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1449s21c1
Sequence:CCGGTGAGAAGGCAATGATACAATTCTCGAGAATTGTATCATTGCCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173615.3-3820s21c1
Sequence:CCGGATTCCCGGGTCTTAATCTAACCTCGAGGTTAGATTAAGACCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1790s21c1
Sequence:CCGGCCGTGAGTCACAACAATTTACCTCGAGGTAAATTGTTGTGACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173615.3-1643s21c1
Sequence:CCGGTCGATATCTCTGCGACCAATTCTCGAGAATTGGTCGCAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks