EMAIL THIS PAGE TO A FRIEND

VWA3B

von Willebrand factor A domain containing 3B

Gene ID:
Mouse(70853) von Willebrand factor A domain containing 3B
Rat(501126) von Willebrand factor A domain containing 3B
domestic guinea pig(100713200) von Willebrand factor A domain containing 3B
naked mole-rat(101717842) von Willebrand factor A domain containing 3B
Domestic Rabbit(100349988) von Willebrand factor A domain containing 3B
cow(536340) von Willebrand factor A domain containing 3B
sheep(101112127) von Willebrand factor A domain containing 3B
chicken(418688) von Willebrand factor A domain containing 3B
Horse(100061406) von Willebrand factor A domain containing 3B
domestic cat(101096802) von Willebrand factor A domain containing 3B
dog(474564) von Willebrand factor A domain containing 3B
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144992 Rosetta Predictions human pricing
XM_001055017 Rosetta Predictions rat pricing
XM_001057173 Rosetta Predictions rat pricing
NM_027580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104263 predicted 2760
2 SASI_Hs01_00104264 predicted 2107
3 SASI_Hs02_00364813 predicted 3274
4 SASI_Hs01_00104266 predicted 1381
5 SASI_Hs02_00364814 predicted 3362
6 SASI_Hs01_00104269 predicted 559
7 SASI_Hs01_00104270 predicted 1180
8 SASI_Hs01_00104271 predicted 740
9 SASI_Hs01_00104272 predicted 615
10 SASI_Hs02_00364815 predicted 4192
11 SASI_Hs01_00104265 predicted 480
12 SASI_Hs01_00104267 predicted 1793
13 SASI_Hs01_00104268 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278122 predicted 3268
2 SASI_Rn02_00278123 predicted 3347
3 SASI_Rn02_00278124 predicted 3379
4 SASI_Rn02_00278125 predicted 3266
5 SASI_Rn02_00278126 predicted 3478
6 SASI_Rn02_00278127 predicted 3320
7 SASI_Rn02_00278128 predicted 3351
8 SASI_Rn02_00278129 predicted 3368
9 SASI_Rn02_00278130 predicted 3433
10 SASI_Rn02_00278131 predicted 3369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285666 predicted 2710
2 SASI_Rn02_00285667 predicted 1764
3 SASI_Rn02_00285668 predicted 266
4 SASI_Rn02_00285669 predicted 1661
5 SASI_Rn02_00285670 predicted 817
6 SASI_Rn02_00285671 predicted 1654
7 SASI_Rn02_00285672 predicted 1549
8 SASI_Rn02_00285673 predicted 1532
9 SASI_Rn02_00285674 predicted 1909
10 SASI_Rn02_00285675 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084868 predicted 238
2 SASI_Mm01_00084869 predicted 933
3 SASI_Mm01_00084870 predicted 267
4 SASI_Mm01_00084871 predicted 845
5 SASI_Mm01_00084872 predicted 911
6 SASI_Mm01_00084873 predicted 435
7 SASI_Mm01_00084874 predicted 1120
8 SASI_Mm01_00084875 predicted 1105
9 SASI_Mm01_00084876 predicted 438
10 SASI_Mm01_00084877 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144992
VWA3B MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 3B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-1646s21c1
Sequence:CCGGGCTTGGTCCACGTCAACATTACTCGAGTAATGTTGACGTGGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-2912s21c1
Sequence:CCGGATGTCGTGTCTAAGGTCTTTGCTCGAGCAAAGACCTTAGACACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144992.4-4553s21c1
Sequence:CCGGACCCAATATTAGGACTGAAATCTCGAGATTTCAGTCCTAATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-960s21c1
Sequence:CCGGCAAGACTATTGAATCCATTTACTCGAGTAAATGGATTCAATAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-739s21c1
Sequence:CCGGTGCCGAGAGGCTCTAACAATGCTCGAGCATTGTTAGAGCCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-668s1c1
Sequence:CCGGCCAGAGGCTGTTCAGAATGAACTCGAGTTCATTCTGAACAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-1975s1c1
Sequence:CCGGGATACCCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144992
VWA3B MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 3B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-1646s21c1
Sequence:CCGGGCTTGGTCCACGTCAACATTACTCGAGTAATGTTGACGTGGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-2912s21c1
Sequence:CCGGATGTCGTGTCTAAGGTCTTTGCTCGAGCAAAGACCTTAGACACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144992.4-4553s21c1
Sequence:CCGGACCCAATATTAGGACTGAAATCTCGAGATTTCAGTCCTAATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-960s21c1
Sequence:CCGGCAAGACTATTGAATCCATTTACTCGAGTAAATGGATTCAATAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-739s21c1
Sequence:CCGGTGCCGAGAGGCTCTAACAATGCTCGAGCATTGTTAGAGCCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-668s1c1
Sequence:CCGGCCAGAGGCTGTTCAGAATGAACTCGAGTTCATTCTGAACAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-1975s1c1
Sequence:CCGGGATACCCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144992
VWA3B MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 3B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-1646s21c1
Sequence:CCGGGCTTGGTCCACGTCAACATTACTCGAGTAATGTTGACGTGGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-2912s21c1
Sequence:CCGGATGTCGTGTCTAAGGTCTTTGCTCGAGCAAAGACCTTAGACACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144992.4-4553s21c1
Sequence:CCGGACCCAATATTAGGACTGAAATCTCGAGATTTCAGTCCTAATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-960s21c1
Sequence:CCGGCAAGACTATTGAATCCATTTACTCGAGTAAATGGATTCAATAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144992.4-739s21c1
Sequence:CCGGTGCCGAGAGGCTCTAACAATGCTCGAGCATTGTTAGAGCCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-668s1c1
Sequence:CCGGCCAGAGGCTGTTCAGAATGAACTCGAGTTCATTCTGAACAGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144992.2-1975s1c1
Sequence:CCGGGATACCCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027580
VWA3B MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 3B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-230s1c1
Sequence:CCGGCAGCAATAAGATGGTATTAATCTCGAGATTAATACCATCTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-839s1c1
Sequence:CCGGGACAAGCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-297s1c1
Sequence:CCGGCAGGCCATCAAATCCTATGAACTCGAGTTCATAGGATTTGATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.1-584s1c1
Sequence:CCGGGCAAGGGTATCCAACGAAGAACTCGAGTTCTTCGTTGGATACCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-867s1c1
Sequence:CCGGCCCGCCATTGTTATAGCACTTCTCGAGAAGTGCTATAACAATGGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-437s1c1
Sequence:CCGGGCTGAATTGGCCCATTTCATTCTCGAGAATGAAATGGGCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027580.1-1366s1c1
Sequence:CCGGGTGGCAGCTAACTTTAAGCAACTCGAGTTGCTTAAAGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-998s1c1
Sequence:CCGGCCTGTCTTGCTCAATGATACACTCGAGTGTATCATTGAGCAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027580
VWA3B MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 3B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-230s1c1
Sequence:CCGGCAGCAATAAGATGGTATTAATCTCGAGATTAATACCATCTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-839s1c1
Sequence:CCGGGACAAGCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-297s1c1
Sequence:CCGGCAGGCCATCAAATCCTATGAACTCGAGTTCATAGGATTTGATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.1-584s1c1
Sequence:CCGGGCAAGGGTATCCAACGAAGAACTCGAGTTCTTCGTTGGATACCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-867s1c1
Sequence:CCGGCCCGCCATTGTTATAGCACTTCTCGAGAAGTGCTATAACAATGGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-437s1c1
Sequence:CCGGGCTGAATTGGCCCATTTCATTCTCGAGAATGAAATGGGCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027580.1-1366s1c1
Sequence:CCGGGTGGCAGCTAACTTTAAGCAACTCGAGTTGCTTAAAGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-998s1c1
Sequence:CCGGCCTGTCTTGCTCAATGATACACTCGAGTGTATCATTGAGCAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027580
VWA3B MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 3B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-230s1c1
Sequence:CCGGCAGCAATAAGATGGTATTAATCTCGAGATTAATACCATCTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-839s1c1
Sequence:CCGGGACAAGCAAAGGATTTGACTTCTCGAGAAGTCAAATCCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.2-297s1c1
Sequence:CCGGCAGGCCATCAAATCCTATGAACTCGAGTTCATAGGATTTGATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027580.1-584s1c1
Sequence:CCGGGCAAGGGTATCCAACGAAGAACTCGAGTTCTTCGTTGGATACCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-867s1c1
Sequence:CCGGCCCGCCATTGTTATAGCACTTCTCGAGAAGTGCTATAACAATGGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-437s1c1
Sequence:CCGGGCTGAATTGGCCCATTTCATTCTCGAGAATGAAATGGGCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027580.1-1366s1c1
Sequence:CCGGGTGGCAGCTAACTTTAAGCAACTCGAGTTGCTTAAAGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027580.1-998s1c1
Sequence:CCGGCCTGTCTTGCTCAATGATACACTCGAGTGTATCATTGAGCAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks