EMAIL THIS PAGE TO A FRIEND

VWA5A

von Willebrand factor A domain containing 5A

Synonyms: BCSC-1 BCSC1 LOH11CR2A
UniProtKB ID: O00534, Q6UN19, Q6UN20, Q9BVF8
Gene ID:
Mouse(67776) von Willebrand factor A domain containing 5A
Rat(301097) von Willebrand factor A domain containing 5A
chicken(431270) von Willebrand factor A domain containing 5A
domestic cat(101096008) von Willebrand factor A domain containing 5A
dog(489335) von Willebrand factor A domain containing 5A
Horse(100071957) von Willebrand factor A domain containing 5A
cow(521780) von Willebrand factor A domain containing 5A
sheep(101105613) von Willebrand factor A domain containing 5A
naked mole-rat(101696998) von Willebrand factor A domain containing 5A
domestic guinea pig(100722734) von Willebrand factor A domain containing 5A
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014622 Rosetta Predictions human pricing
NM_198315 Rosetta Predictions human pricing
NM_198755 Rosetta Predictions rat pricing
XM_001060157 Rosetta Predictions rat pricing
NM_172767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345918 predicted 1059
2 SASI_Hs01_00054712 predicted 340
3 SASI_Hs01_00054713 predicted 856
4 SASI_Hs01_00054714 predicted 1041
5 SASI_Hs01_00054715 predicted 923
6 SASI_Hs01_00054716 predicted 988
7 SASI_Hs01_00054717 predicted 576
8 SASI_Hs01_00054718 predicted 904
9 SASI_Hs01_00054719 predicted 864
10 SASI_Hs01_00054720 predicted 756
11 SASI_Hs01_00054721 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371866 predicted 1061
2 SASI_Hs01_00073632 predicted 341
3 SASI_Hs01_00073633 predicted 852
4 SASI_Hs01_00073634 predicted 1042
5 SASI_Hs01_00073635 predicted 929
6 SASI_Hs01_00073636 predicted 989
7 SASI_Hs01_00073637 predicted 578
8 SASI_Hs01_00073638 predicted 905
9 SASI_Hs01_00073639 predicted 867
10 SASI_Hs01_00073640 predicted 757
11 SASI_Hs01_00073641 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073375 predicted 1326
2 SASI_Rn02_00269984 predicted 742
3 SASI_Rn01_00073376 predicted 748
4 SASI_Rn01_00073377 predicted 1852
5 SASI_Rn01_00073378 predicted 2461
6 SASI_Rn02_00269985 predicted 1757
7 SASI_Rn02_00269986 predicted 1907
8 SASI_Rn01_00073379 predicted 393
9 SASI_Rn01_00073380 predicted 341
10 SASI_Rn01_00073381 predicted 837
11 SASI_Rn01_00073382 predicted 224
12 SASI_Rn01_00073383 predicted 1298
13 SASI_Rn01_00073384 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295538 predicted 1288
2 SASI_Rn02_00295539 predicted 647
3 SASI_Rn02_00295540 predicted 661
4 SASI_Rn02_00295541 predicted 945
5 SASI_Rn02_00295542 predicted 1817
6 SASI_Rn02_00295543 predicted 1187
7 SASI_Rn02_00295544 predicted 1717
8 SASI_Rn02_00295545 predicted 1864
9 SASI_Rn02_00295546 predicted 304
10 SASI_Rn02_00295547 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344644 predicted 1387
2 SASI_Mm01_00095938 predicted 2024
3 SASI_Mm01_00095939 predicted 399
4 SASI_Mm01_00095940 predicted 1174
5 SASI_Mm01_00095941 predicted 310
6 SASI_Mm01_00095942 predicted 2081
7 SASI_Mm01_00095943 predicted 1818
8 SASI_Mm01_00095944 predicted 1833
9 SASI_Mm01_00095945 predicted 1658
10 SASI_Mm01_00095946 predicted 1685
11 SASI_Mm01_00095937 predicted 2649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014622
VWA5A MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014622.3-2368s1c1
Sequence:CCGGCGGTTGTGAAAGCTGCTATTACTCGAGTAATAGCAGCTTTCACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-2173s1c1
Sequence:CCGGCCAAGATCCTAGGTATGAGTTCTCGAGAACTCATACCTAGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1016s1c1
Sequence:CCGGGCTGCTGAAGAGTTTACCTATCTCGAGATAGGTAAACTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1255s1c1
Sequence:CCGGGAGAAGTTACAGACACGTTTACTCGAGTAAACGTGTCTGTAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1609s1c1
Sequence:CCGGCAGGAGAAGTATGCCTCAAATCTCGAGATTTGAGGCATACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-1852s21c1
Sequence:CCGGAGCTTTCATTGCTATCAATAACTCGAGTTATTGATAGCAATGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-162s21c1
Sequence:CCGGGCGTGAACATTTACGAGTTTGCTCGAGCAAACTCGTAAATGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-2053s21c1
Sequence:CCGGGACATTCCAGATGGACGATTACTCGAGTAATCGTCCATCTGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-773s21c1
Sequence:CCGGGACGTGGAACTCCTGATTTACCTCGAGGTAAATCAGGAGTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014622
VWA5A MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014622.3-2368s1c1
Sequence:CCGGCGGTTGTGAAAGCTGCTATTACTCGAGTAATAGCAGCTTTCACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-2173s1c1
Sequence:CCGGCCAAGATCCTAGGTATGAGTTCTCGAGAACTCATACCTAGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1016s1c1
Sequence:CCGGGCTGCTGAAGAGTTTACCTATCTCGAGATAGGTAAACTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1255s1c1
Sequence:CCGGGAGAAGTTACAGACACGTTTACTCGAGTAAACGTGTCTGTAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1609s1c1
Sequence:CCGGCAGGAGAAGTATGCCTCAAATCTCGAGATTTGAGGCATACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-1852s21c1
Sequence:CCGGAGCTTTCATTGCTATCAATAACTCGAGTTATTGATAGCAATGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-162s21c1
Sequence:CCGGGCGTGAACATTTACGAGTTTGCTCGAGCAAACTCGTAAATGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-2053s21c1
Sequence:CCGGGACATTCCAGATGGACGATTACTCGAGTAATCGTCCATCTGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-773s21c1
Sequence:CCGGGACGTGGAACTCCTGATTTACCTCGAGGTAAATCAGGAGTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014622
VWA5A MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014622.3-2368s1c1
Sequence:CCGGCGGTTGTGAAAGCTGCTATTACTCGAGTAATAGCAGCTTTCACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-2173s1c1
Sequence:CCGGCCAAGATCCTAGGTATGAGTTCTCGAGAACTCATACCTAGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1016s1c1
Sequence:CCGGGCTGCTGAAGAGTTTACCTATCTCGAGATAGGTAAACTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1255s1c1
Sequence:CCGGGAGAAGTTACAGACACGTTTACTCGAGTAAACGTGTCTGTAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014622.3-1609s1c1
Sequence:CCGGCAGGAGAAGTATGCCTCAAATCTCGAGATTTGAGGCATACTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-1852s21c1
Sequence:CCGGAGCTTTCATTGCTATCAATAACTCGAGTTATTGATAGCAATGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-162s21c1
Sequence:CCGGGCGTGAACATTTACGAGTTTGCTCGAGCAAACTCGTAAATGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-2053s21c1
Sequence:CCGGGACATTCCAGATGGACGATTACTCGAGTAATCGTCCATCTGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014622.4-773s21c1
Sequence:CCGGGACGTGGAACTCCTGATTTACCTCGAGGTAAATCAGGAGTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172767
VALIDATED
VWA5A MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-284s1c1
Sequence:CCGGGCAACCTTAAATTACGAGAATCTCGAGATTCTCGTAATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-2816s1c1
Sequence:CCGGCCTGCATTATTGTTATCCATTCTCGAGAATGGATAACAATAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1574s1c1
Sequence:CCGGGCAGTGGATAACATCTCTCTACTCGAGTAGAGAGATGTTATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-664s1c1
Sequence:CCGGCAGTTGCTTGAACATCCAGAACTCGAGTTCTGGATGTTCAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1837s1c1
Sequence:CCGGCTTGATTCAGACTAAGGATTTCTCGAGAAATCCTTAGTCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-1692s21c1
Sequence:CCGGGTCAGAGGTTAATCATCTATGCTCGAGCATAGATGATTAACCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2438s21c1
Sequence:CCGGGCCAACGGCACAGACTTAAAGCTCGAGCTTTAAGTCTGTGCCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172767.3-2782s21c1
Sequence:CCGGATGATTGGCATGAGATCTATACTCGAGTATAGATCTCATGCCAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2543s21c1
Sequence:CCGGGCCAATAGTCTCCTGAAATTACTCGAGTAATTTCAGGAGACTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172767
VALIDATED
VWA5A MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-284s1c1
Sequence:CCGGGCAACCTTAAATTACGAGAATCTCGAGATTCTCGTAATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-2816s1c1
Sequence:CCGGCCTGCATTATTGTTATCCATTCTCGAGAATGGATAACAATAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1574s1c1
Sequence:CCGGGCAGTGGATAACATCTCTCTACTCGAGTAGAGAGATGTTATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-664s1c1
Sequence:CCGGCAGTTGCTTGAACATCCAGAACTCGAGTTCTGGATGTTCAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1837s1c1
Sequence:CCGGCTTGATTCAGACTAAGGATTTCTCGAGAAATCCTTAGTCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-1692s21c1
Sequence:CCGGGTCAGAGGTTAATCATCTATGCTCGAGCATAGATGATTAACCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2438s21c1
Sequence:CCGGGCCAACGGCACAGACTTAAAGCTCGAGCTTTAAGTCTGTGCCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172767.3-2782s21c1
Sequence:CCGGATGATTGGCATGAGATCTATACTCGAGTATAGATCTCATGCCAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2543s21c1
Sequence:CCGGGCCAATAGTCTCCTGAAATTACTCGAGTAATTTCAGGAGACTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172767
VALIDATED
VWA5A MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-284s1c1
Sequence:CCGGGCAACCTTAAATTACGAGAATCTCGAGATTCTCGTAATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-2816s1c1
Sequence:CCGGCCTGCATTATTGTTATCCATTCTCGAGAATGGATAACAATAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1574s1c1
Sequence:CCGGGCAGTGGATAACATCTCTCTACTCGAGTAGAGAGATGTTATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172767.2-664s1c1
Sequence:CCGGCAGTTGCTTGAACATCCAGAACTCGAGTTCTGGATGTTCAAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172767.2-1837s1c1
Sequence:CCGGCTTGATTCAGACTAAGGATTTCTCGAGAAATCCTTAGTCTGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-1692s21c1
Sequence:CCGGGTCAGAGGTTAATCATCTATGCTCGAGCATAGATGATTAACCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2438s21c1
Sequence:CCGGGCCAACGGCACAGACTTAAAGCTCGAGCTTTAAGTCTGTGCCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172767.3-2782s21c1
Sequence:CCGGATGATTGGCATGAGATCTATACTCGAGTATAGATCTCATGCCAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172767.3-2543s21c1
Sequence:CCGGGCCAATAGTCTCCTGAAATTACTCGAGTAATTTCAGGAGACTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks