EMAIL THIS PAGE TO A FRIEND

VWA5B1

von Willebrand factor A domain containing 5B1

UniProtKB ID: Q5TIE3, A4IF35, A4IF36, Q3ZCM4, Q6ZUB4, Q96M71
Gene ID:
Mouse(75718) von Willebrand factor A domain containing 5B1
Rat(313653) von Willebrand factor A domain containing 5B1
domestic guinea pig(100721616) von Willebrand factor A domain containing 5B1
naked mole-rat(101712382) von Willebrand factor A domain containing 5B1
cow(100336594) von Willebrand factor A domain containing 5B1
sheep(101103135) von Willebrand factor A domain containing 5B1
Zebrafish(564493) von Willebrand factor A domain containing 5B1
Horse(100630570) von Willebrand factor A domain containing 5B1
domestic cat(101092379) von Willebrand factor A domain containing 5B1
dog(478205) von Willebrand factor A domain containing 5B1
chicken(771681) von Willebrand factor A domain containing 5B1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039500 Rosetta Predictions human pricing
XM_001720309 Rosetta Predictions human pricing
XM_001722222 Rosetta Predictions human pricing
XM_001722706 Rosetta Predictions human pricing
NM_001107988 Rosetta Predictions rat pricing
XM_144060 Rosetta Predictions mouse pricing
XM_914601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171619 predicted 1646
2 SASI_Hs01_00171620 predicted 1223
3 SASI_Hs01_00171621 predicted 2319
4 SASI_Hs01_00171622 predicted 1542
5 SASI_Hs01_00171623 predicted 2229
6 SASI_Hs01_00171624 predicted 1235
7 SASI_Hs01_00171625 predicted 1461
8 SASI_Hs01_00171626 predicted 2263
9 SASI_Hs01_00171627 predicted 2223
10 SASI_Hs01_00171628 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435855 predicted 226
2 SASI_Hs02_00435856 predicted 1039
3 SASI_Hs02_00435857 predicted 1422
4 SASI_Hs02_00435858 predicted 1032
5 SASI_Hs02_00435859 predicted 203
6 SASI_Hs02_00435860 predicted 2796
7 SASI_Hs02_00435861 predicted 3167
8 SASI_Hs02_00435862 predicted 3279
9 SASI_Hs02_00435863 predicted 226
10 SASI_Hs02_00435864 predicted 2686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447840 predicted 229
2 SASI_Hs02_00447841 predicted 1045
3 SASI_Hs02_00447842 predicted 2033
4 SASI_Hs02_00447843 predicted 1423
5 SASI_Hs02_00447844 predicted 1030
6 SASI_Hs02_00447845 predicted 210
7 SASI_Hs02_00447846 predicted 2801
8 SASI_Hs02_00447847 predicted 3166
9 SASI_Hs02_00447848 predicted 3276
10 SASI_Hs02_00447849 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00450817 predicted 366
2 SASI_Hs02_00450818 predicted 1184
3 SASI_Hs02_00450819 predicted 2176
4 SASI_Hs02_00450820 predicted 1566
5 SASI_Hs02_00450821 predicted 1162
6 SASI_Hs02_00450822 predicted 348
7 SASI_Hs02_00450823 predicted 2930
8 SASI_Hs02_00450824 predicted 3299
9 SASI_Hs02_00450825 predicted 3418
10 SASI_Hs02_00450826 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234255 predicted 3361
2 SASI_Rn02_00234256 predicted 1846
3 SASI_Rn02_00234257 predicted 1053
4 SASI_Rn02_00234258 predicted 2065
5 SASI_Rn02_00234259 predicted 1543
6 SASI_Rn02_00234260 predicted 3481
7 SASI_Rn02_00234261 predicted 2868
8 SASI_Rn02_00234262 predicted 3139
9 SASI_Rn02_00234263 predicted 2939
10 SASI_Rn02_00234264 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425211 predicted 1115
2 SASI_Mm02_00425212 predicted 1556
3 SASI_Mm01_00210944 predicted 1868
4 SASI_Mm02_00425213 predicted 1208
5 SASI_Mm02_00425214 predicted 2230
6 SASI_Mm01_00210947 predicted 1850
7 SASI_Mm02_00425215 predicted 1044
8 SASI_Mm01_00210950 predicted 1957
9 SASI_Mm01_00210951 predicted 1804
10 SASI_Mm02_00425216 predicted 2216
11 SASI_Mm01_00210943 predicted 2219
12 SASI_Mm01_00210945 predicted 2449
13 SASI_Mm01_00210946 predicted 3157
14 SASI_Mm01_00210948 predicted 3260
15 SASI_Mm01_00210949 predicted 2663
16 SASI_Mm01_00210952 predicted 2997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438720 predicted 3583
2 SASI_Mm02_00438721 predicted 1873
3 SASI_Mm02_00438722 predicted 3142
4 SASI_Mm02_00438723 predicted 1204
5 SASI_Mm02_00438724 predicted 1850
6 SASI_Mm02_00438725 predicted 1049
7 SASI_Mm02_00438726 predicted 3262
8 SASI_Mm02_00438727 predicted 2651
9 SASI_Mm02_00438728 predicted 1957
10 SASI_Mm02_00438729 predicted 1808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029401
VWA5B1 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1649s21c1
Sequence:CCGGTGCAACCAAAGATGGTCAAATCTCGAGATTTGACCATCTTTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-676s21c1
Sequence:CCGGCAGACCAAGGACTCCTATAACCTCGAGGTTATAGGAGTCCTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1574s21c1
Sequence:CCGGTCTGCTACCGACTGGTCAAAGCTCGAGCTTTGACCAGTCGGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-2199s21c1
Sequence:CCGGTGATCTGCAGACCCTACTTAACTCGAGTTAAGTAGGGTCTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-260s21c1
Sequence:CCGGTGTATCCAATAGACGAGTATACTCGAGTATACTCGTCTATTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029401
VWA5B1 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1649s21c1
Sequence:CCGGTGCAACCAAAGATGGTCAAATCTCGAGATTTGACCATCTTTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-676s21c1
Sequence:CCGGCAGACCAAGGACTCCTATAACCTCGAGGTTATAGGAGTCCTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1574s21c1
Sequence:CCGGTCTGCTACCGACTGGTCAAAGCTCGAGCTTTGACCAGTCGGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-2199s21c1
Sequence:CCGGTGATCTGCAGACCCTACTTAACTCGAGTTAAGTAGGGTCTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-260s21c1
Sequence:CCGGTGTATCCAATAGACGAGTATACTCGAGTATACTCGTCTATTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029401
VWA5B1 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1649s21c1
Sequence:CCGGTGCAACCAAAGATGGTCAAATCTCGAGATTTGACCATCTTTGGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-676s21c1
Sequence:CCGGCAGACCAAGGACTCCTATAACCTCGAGGTTATAGGAGTCCTTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-1574s21c1
Sequence:CCGGTCTGCTACCGACTGGTCAAAGCTCGAGCTTTGACCAGTCGGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-2199s21c1
Sequence:CCGGTGATCTGCAGACCCTACTTAACTCGAGTTAAGTAGGGTCTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029401.1-260s21c1
Sequence:CCGGTGTATCCAATAGACGAGTATACTCGAGTATACTCGTCTATTGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144623
VWA5B1 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5B1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000181011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1170s1c1
Sequence:CCGGGCTCACAGACATTGATGGGTTCTCGAGAACCCATCAATGTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1121s1c1
Sequence:CCGGCAGACGATGCTTGGAGAAGATCTCGAGATCTTCTCCAAGCATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144623
VWA5B1 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5B1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000181011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1170s1c1
Sequence:CCGGGCTCACAGACATTGATGGGTTCTCGAGAACCCATCAATGTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1121s1c1
Sequence:CCGGCAGACGATGCTTGGAGAAGATCTCGAGATCTTCTCCAAGCATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144623
VWA5B1 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5B1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000181011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1170s1c1
Sequence:CCGGGCTCACAGACATTGATGGGTTCTCGAGAACCCATCAATGTCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144623.1-1121s1c1
Sequence:CCGGCAGACGATGCTTGGAGAAGATCTCGAGATCTTCTCCAAGCATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks