EMAIL THIS PAGE TO A FRIEND

VWA5B2

von Willebrand factor A domain containing 5B2

UniProtKB ID: Q8N398, B9EGN7
Gene ID:
Mouse(328643) von Willebrand factor A domain containing 5B2
Rat(303812) von Willebrand factor A domain containing 5B2
chicken(424951) von Willebrand factor A domain containing 5B2
domestic cat(101095432) von Willebrand factor A domain containing 5B2
Horse(100067050) von Willebrand factor A domain containing 5B2
dog(488104) von Willebrand factor A domain containing 5B2
cow(506558) von Willebrand factor A domain containing 5B2
sheep(101107661) von Willebrand factor A domain containing 5B2
naked mole-rat(101714412) von Willebrand factor A domain containing 5B2
Domestic Rabbit(100349680) von Willebrand factor A domain containing 5B2
domestic guinea pig(100728837) von Willebrand factor A domain containing 5B2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144791 MISSION® esiRNA esiRNA human VWA5B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716350 Rosetta Predictions human pricing
XM_291077 Rosetta Predictions human pricing
XM_941833 Rosetta Predictions human pricing
NM_001134535 Rosetta Predictions rat pricing
NM_182636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00409983 predicted 1720
2 SASI_Hs02_00409984 predicted 1710
3 SASI_Hs02_00409985 predicted 461
4 SASI_Hs02_00409986 predicted 2196
5 SASI_Hs02_00409987 predicted 1715
6 SASI_Hs02_00409988 predicted 1647
7 SASI_Hs02_00409989 predicted 2207
8 SASI_Hs02_00409990 predicted 1725
9 SASI_Hs02_00409991 predicted 2681
10 SASI_Hs02_00409992 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264937 predicted 1993
2 SASI_Hs01_00264938 predicted 1976
3 SASI_Hs02_00479042 predicted 727
4 SASI_Hs01_00264939 predicted 2458
5 SASI_Hs01_00264941 predicted 1974
6 SASI_Hs01_00264942 predicted 1916
7 SASI_Hs01_00264943 predicted 2468
8 SASI_Hs01_00264944 predicted 1992
9 SASI_Hs01_00264945 predicted 2944
10 SASI_Hs01_00264946 predicted 1695
11 SASI_Hs01_00264940 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485147 predicted 1988
2 SASI_Hs02_00485148 predicted 1981
3 SASI_Hs02_00485149 predicted 729
4 SASI_Hs02_00485150 predicted 2461
5 SASI_Hs02_00485151 predicted 1975
6 SASI_Hs02_00485152 predicted 1917
7 SASI_Hs02_00485153 predicted 2473
8 SASI_Hs02_00485154 predicted 1989
9 SASI_Hs02_00485155 predicted 2951
10 SASI_Hs02_00485156 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256839 predicted 2042
2 SASI_Rn02_00256840 predicted 3882
3 SASI_Rn02_00256841 predicted 2698
4 SASI_Rn02_00256842 predicted 1409
5 SASI_Rn02_00256843 predicted 1916
6 SASI_Rn02_00256844 predicted 3886
7 SASI_Rn02_00256845 predicted 3669
8 SASI_Rn02_00256846 predicted 2051
9 SASI_Rn02_00256847 predicted 2728
10 SASI_Rn02_00256848 predicted 2966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033028 predicted 1638
2 SASI_Mm01_00033029 predicted 1703
3 SASI_Mm01_00033031 predicted 1809
4 SASI_Mm01_00033033 predicted 1186
5 SASI_Mm02_00349949 predicted 1858
6 SASI_Mm01_00033034 predicted 2145
7 SASI_Mm01_00033035 predicted 1623
8 SASI_Mm01_00033036 predicted 1212
9 SASI_Mm01_00033037 predicted 2080
10 SASI_Mm02_00349950 predicted 1122
11 SASI_Mm01_00033030 predicted 1840
12 SASI_Mm01_00033032 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138345
VWA5B2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5B2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1454s21c1
Sequence:CCGGACCAGCTGCTCCAGGGTTTATCTCGAGATAAACCCTGGAGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138345.1-3800s21c1
Sequence:CCGGTCTTGGTGCTGGGAAAGTGTACTCGAGTACACTTTCCCAGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2941s21c1
Sequence:CCGGCCCACTGTTGTCTACTCTAAACTCGAGTTTAGAGTAGACAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1964s21c1
Sequence:CCGGTCTTTCAGTCCTCGTACATTCCTCGAGGAATGTACGAGGACTGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2432s21c1
Sequence:CCGGTGATGGAACCACCCTTCTTATCTCGAGATAAGAAGGGTGGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138345
VWA5B2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5B2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1454s21c1
Sequence:CCGGACCAGCTGCTCCAGGGTTTATCTCGAGATAAACCCTGGAGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138345.1-3800s21c1
Sequence:CCGGTCTTGGTGCTGGGAAAGTGTACTCGAGTACACTTTCCCAGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2941s21c1
Sequence:CCGGCCCACTGTTGTCTACTCTAAACTCGAGTTTAGAGTAGACAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1964s21c1
Sequence:CCGGTCTTTCAGTCCTCGTACATTCCTCGAGGAATGTACGAGGACTGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2432s21c1
Sequence:CCGGTGATGGAACCACCCTTCTTATCTCGAGATAAGAAGGGTGGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138345
VWA5B2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5B2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1454s21c1
Sequence:CCGGACCAGCTGCTCCAGGGTTTATCTCGAGATAAACCCTGGAGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138345.1-3800s21c1
Sequence:CCGGTCTTGGTGCTGGGAAAGTGTACTCGAGTACACTTTCCCAGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2941s21c1
Sequence:CCGGCCCACTGTTGTCTACTCTAAACTCGAGTTTAGAGTAGACAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-1964s21c1
Sequence:CCGGTCTTTCAGTCCTCGTACATTCCTCGAGGAATGTACGAGGACTGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138345.1-2432s21c1
Sequence:CCGGTGATGGAACCACCCTTCTTATCTCGAGATAAGAAGGGTGGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182636
VWA5B2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 5B2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1866s21c1
Sequence:CCGGCACCAAGCCCTGGAGTTTATGCTCGAGCATAAACTCCAGGGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-796s21c1
Sequence:CCGGAGGGTCATCTTGTCTTGAATCCTCGAGGATTCAAGACAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1757s21c1
Sequence:CCGGCCCTGATATGCTGGCTGTATTCTCGAGAATACAGCCAGCATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1632s21c1
Sequence:CCGGCTAGTCAACCTAGCCATATTTCTCGAGAAATATGGCTAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1122s21c1
Sequence:CCGGGCTCCGTATACCTTCTCTTTCCTCGAGGAAAGAGAAGGTATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182636
VWA5B2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 5B2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1866s21c1
Sequence:CCGGCACCAAGCCCTGGAGTTTATGCTCGAGCATAAACTCCAGGGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-796s21c1
Sequence:CCGGAGGGTCATCTTGTCTTGAATCCTCGAGGATTCAAGACAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1757s21c1
Sequence:CCGGCCCTGATATGCTGGCTGTATTCTCGAGAATACAGCCAGCATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1632s21c1
Sequence:CCGGCTAGTCAACCTAGCCATATTTCTCGAGAAATATGGCTAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1122s21c1
Sequence:CCGGGCTCCGTATACCTTCTCTTTCCTCGAGGAAAGAGAAGGTATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182636
VWA5B2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 5B2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1866s21c1
Sequence:CCGGCACCAAGCCCTGGAGTTTATGCTCGAGCATAAACTCCAGGGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-796s21c1
Sequence:CCGGAGGGTCATCTTGTCTTGAATCCTCGAGGATTCAAGACAAGATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1757s21c1
Sequence:CCGGCCCTGATATGCTGGCTGTATTCTCGAGAATACAGCCAGCATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1632s21c1
Sequence:CCGGCTAGTCAACCTAGCCATATTTCTCGAGAAATATGGCTAGGTTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182636.4-1122s21c1
Sequence:CCGGGCTCCGTATACCTTCTCTTTCCTCGAGGAAAGAGAAGGTATACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks