EMAIL THIS PAGE TO A FRIEND

VWA7

von Willebrand factor A domain containing 7

Synonyms: C6orf27 G7c NG37
Gene ID:
Mouse(27762) von Willebrand factor A domain containing 7
Rat(309611) von Willebrand factor A domain containing 7
domestic guinea pig(100729737) von Willebrand factor A domain containing 7
naked mole-rat(101713578) von Willebrand factor A domain containing 7
cow(505555) von Willebrand factor A domain containing 7
sheep(101103099) von Willebrand factor A domain containing 7
domestic cat(101090517) von Willebrand factor A domain containing 7
dog(607423) von Willebrand factor A domain containing 7
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025258 Rosetta Predictions human pricing
NM_212499 Rosetta Predictions rat pricing
NM_138582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160731 predicted 1291
2 SASI_Hs01_00160732 predicted 2506
3 SASI_Hs02_00358100 predicted 2693
4 SASI_Hs01_00160733 predicted 1545
5 SASI_Hs01_00160734 predicted 2030
6 SASI_Hs01_00160735 predicted 2186
7 SASI_Hs02_00358101 predicted 1083
8 SASI_Hs01_00160736 predicted 459
9 SASI_Hs01_00160737 predicted 611
10 SASI_Hs01_00160738 predicted 1950
11 SASI_Hs01_00160739 predicted 272
12 SASI_Hs01_00160740 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087642 predicted 1570
2 SASI_Rn01_00087643 predicted 812
3 SASI_Rn01_00087644 predicted 2465
4 SASI_Rn01_00087645 predicted 352
5 SASI_Rn01_00087646 predicted 2465
6 SASI_Rn01_00087647 predicted 1800
7 SASI_Rn01_00087648 predicted 868
8 SASI_Rn01_00087649 predicted 505
9 SASI_Rn01_00087650 predicted 1048
10 SASI_Rn02_00270481 predicted 2004
11 SASI_Rn01_00087651 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116343 predicted 1171
2 SASI_Mm01_00116344 predicted 819
3 SASI_Mm01_00116345 predicted 2467
4 SASI_Mm01_00116346 predicted 459
5 SASI_Mm01_00116347 predicted 2471
6 SASI_Mm01_00116348 predicted 355
7 SASI_Mm01_00116349 predicted 1809
8 SASI_Mm01_00116350 predicted 2013
9 SASI_Mm02_00339635 predicted 472
10 SASI_Mm02_00339636 predicted 860
11 SASI_Mm01_00116351 predicted 1522
12 SASI_Mm01_00116352 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025258
VWA7 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-2510s21c1
Sequence:CCGGGACCTTAGGACTTTCGTCAACCTCGAGGTTGACGAAAGTCCTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-1327s21c1
Sequence:CCGGGTTCGGCCCTGTCTTTACAACCTCGAGGTTGTAAAGACAGGGCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025258.1-1095s1c1
Sequence:CCGGCCCTGTCTTTACAACCAGTGACTCGAGTCACTGGTTGTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1318s1c1
Sequence:CCGGGTAACATTCCTGGTGACTGAACTCGAGTTCAGTCACCAGGAATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-244s1c1
Sequence:CCGGCTCCTTGCTGATGACCTCTTTCTCGAGAAAGAGGTCATCAGCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1231s1c1
Sequence:CCGGGATATCTTTGTCTTCACGGATCTCGAGATCCGTGAAGACAAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1137s1c1
Sequence:CCGGGCTTAATGAGATCCATGCCTTCTCGAGAAGGCATGGATCTCATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025258
VWA7 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-2510s21c1
Sequence:CCGGGACCTTAGGACTTTCGTCAACCTCGAGGTTGACGAAAGTCCTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-1327s21c1
Sequence:CCGGGTTCGGCCCTGTCTTTACAACCTCGAGGTTGTAAAGACAGGGCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025258.1-1095s1c1
Sequence:CCGGCCCTGTCTTTACAACCAGTGACTCGAGTCACTGGTTGTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1318s1c1
Sequence:CCGGGTAACATTCCTGGTGACTGAACTCGAGTTCAGTCACCAGGAATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-244s1c1
Sequence:CCGGCTCCTTGCTGATGACCTCTTTCTCGAGAAAGAGGTCATCAGCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1231s1c1
Sequence:CCGGGATATCTTTGTCTTCACGGATCTCGAGATCCGTGAAGACAAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1137s1c1
Sequence:CCGGGCTTAATGAGATCCATGCCTTCTCGAGAAGGCATGGATCTCATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025258
VWA7 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-2510s21c1
Sequence:CCGGGACCTTAGGACTTTCGTCAACCTCGAGGTTGACGAAAGTCCTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025258.2-1327s21c1
Sequence:CCGGGTTCGGCCCTGTCTTTACAACCTCGAGGTTGTAAAGACAGGGCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025258.1-1095s1c1
Sequence:CCGGCCCTGTCTTTACAACCAGTGACTCGAGTCACTGGTTGTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1318s1c1
Sequence:CCGGGTAACATTCCTGGTGACTGAACTCGAGTTCAGTCACCAGGAATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-244s1c1
Sequence:CCGGCTCCTTGCTGATGACCTCTTTCTCGAGAAAGAGGTCATCAGCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1231s1c1
Sequence:CCGGGATATCTTTGTCTTCACGGATCTCGAGATCCGTGAAGACAAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025258.1-1137s1c1
Sequence:CCGGGCTTAATGAGATCCATGCCTTCTCGAGAAGGCATGGATCTCATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138582
VWA7 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1888s21c1
Sequence:CCGGACTCGTCGCTTTGGGCAATTCCTCGAGGAATTGCCCAAAGCGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138582.1-3198s21c1
Sequence:CCGGAGAGCAGTCAGGTCCCTTTATCTCGAGATAAAGGGACCTGACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-368s21c1
Sequence:CCGGATGTCACCCTTGTGCTCTTTCCTCGAGGAAAGAGCACAAGGGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-656s21c1
Sequence:CCGGCTGCCAGAGCCCTCGAATATACTCGAGTATATTCGAGGGCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1176s21c1
Sequence:CCGGAGGCAGTATGGGCGAGGAAATCTCGAGATTTCCTCGCCCATACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138582
VWA7 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1888s21c1
Sequence:CCGGACTCGTCGCTTTGGGCAATTCCTCGAGGAATTGCCCAAAGCGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138582.1-3198s21c1
Sequence:CCGGAGAGCAGTCAGGTCCCTTTATCTCGAGATAAAGGGACCTGACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-368s21c1
Sequence:CCGGATGTCACCCTTGTGCTCTTTCCTCGAGGAAAGAGCACAAGGGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-656s21c1
Sequence:CCGGCTGCCAGAGCCCTCGAATATACTCGAGTATATTCGAGGGCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1176s21c1
Sequence:CCGGAGGCAGTATGGGCGAGGAAATCTCGAGATTTCCTCGCCCATACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138582
VWA7 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1888s21c1
Sequence:CCGGACTCGTCGCTTTGGGCAATTCCTCGAGGAATTGCCCAAAGCGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138582.1-3198s21c1
Sequence:CCGGAGAGCAGTCAGGTCCCTTTATCTCGAGATAAAGGGACCTGACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-368s21c1
Sequence:CCGGATGTCACCCTTGTGCTCTTTCCTCGAGGAAAGAGCACAAGGGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-656s21c1
Sequence:CCGGCTGCCAGAGCCCTCGAATATACTCGAGTATATTCGAGGGCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138582.1-1176s21c1
Sequence:CCGGAGGCAGTATGGGCGAGGAAATCTCGAGATTTCCTCGCCCATACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks