EMAIL THIS PAGE TO A FRIEND

VWA8

von Willebrand factor A domain containing 8

Synonyms: KIAA0564
Gene ID:
Mouse(219189) von Willebrand factor A domain containing 8
Rat(290381) von Willebrand factor A domain containing 8
Zebrafish(561317) von Willebrand factor A domain containing 8
dog(485463) von Willebrand factor A domain containing 8
cow(524159) von Willebrand factor A domain containing 8
sheep(101123387) von Willebrand factor A domain containing 8
naked mole-rat(101698442) von Willebrand factor A domain containing 8
domestic guinea pig(100735867) von Willebrand factor A domain containing 8
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0894 AQUA Peptide QLEDG[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009814 Rosetta Predictions human pricing
NM_015058 Rosetta Predictions human pricing
XM_214237 Rosetta Predictions rat pricing
XR_008855 Rosetta Predictions rat pricing
XM_001002205 Rosetta Predictions mouse pricing
XM_915363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243887 predicted 838
2 SASI_Hs01_00243888 predicted 2272
3 SASI_Hs02_00305690 predicted 1067
4 SASI_Hs02_00305691 predicted 1907
5 SASI_Hs01_00243890 predicted 2786
6 SASI_Hs01_00243891 predicted 774
7 SASI_Hs01_00243893 predicted 1759
8 SASI_Hs01_00243894 predicted 1792
9 SASI_Hs01_00243895 predicted 419
10 SASI_Hs01_00243896 predicted 2253
11 SASI_Hs01_00243889 predicted 1522
12 SASI_Hs01_00243892 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182830 predicted 839
2 SASI_Hs01_00182831 predicted 2267
3 SASI_Hs02_00346911 predicted 1071
4 SASI_Hs02_00346912 predicted 1904
5 SASI_Hs01_00182833 predicted 2789
6 SASI_Hs01_00182834 predicted 771
7 SASI_Hs01_00182836 predicted 1750
8 SASI_Hs01_00182837 predicted 1799
9 SASI_Hs01_00182838 predicted 422
10 SASI_Hs01_00182839 predicted 2257
11 SASI_Hs01_00182832 predicted 1521
12 SASI_Hs01_00182835 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375179 predicted 4323
2 SASI_Rn02_00375180 predicted 6079
3 SASI_Rn02_00375181 predicted 4610
4 SASI_Rn02_00375182 predicted 1663
5 SASI_Rn02_00375183 predicted 3291
6 SASI_Rn02_00375184 predicted 5229
7 SASI_Rn02_00375185 predicted 5241
8 SASI_Rn02_00375186 predicted 2576
9 SASI_Rn02_00375187 predicted 3558
10 SASI_Rn02_00375188 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141205 predicted 4345
2 SASI_Rn01_00141206 predicted 6347
3 SASI_Rn01_00141207 predicted 6743
4 SASI_Rn01_00141208 predicted 6104
5 SASI_Rn01_00141209 predicted 4626
6 SASI_Rn01_00141211 predicted 3312
7 SASI_Rn01_00141212 predicted 5257
8 SASI_Rn01_00141213 predicted 5265
9 SASI_Rn01_00141214 predicted 2577
10 SASI_Rn02_00418078 predicted 1019
11 SASI_Rn01_00141210 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355450 predicted 308
2 SASI_Mm01_00258411 predicted 1992
3 SASI_Mm01_00258412 predicted 788
4 SASI_Mm01_00258413 predicted 942
5 SASI_Mm02_00355451 predicted 719
6 SASI_Mm01_00258414 predicted 1112
7 SASI_Mm01_00258415 predicted 901
8 SASI_Mm01_00258417 predicted 802
9 SASI_Mm02_00355452 predicted 2495
10 SASI_Mm01_00258418 predicted 457
11 SASI_Mm01_00258410 predicted 1279
12 SASI_Mm01_00258416 predicted 1226
13 SASI_Mm01_00258419 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439377 predicted 2416
2 SASI_Mm02_00439378 predicted 2695
3 SASI_Mm02_00439379 predicted 2756
4 SASI_Mm02_00439380 predicted 3408
5 SASI_Mm02_00439381 predicted 797
6 SASI_Mm02_00439382 predicted 5651
7 SASI_Mm02_00439383 predicted 4352
8 SASI_Mm02_00439384 predicted 2335
9 SASI_Mm02_00439385 predicted 4159
10 SASI_Mm02_00439386 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015058
VWA8 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-5727s1c1
Sequence:CCGGCCAAGGATATCCCTCAGATTTCTCGAGAAATCTGAGGGATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1296s1c1
Sequence:CCGGCCAGGCTATTAAGTCAACCTTCTCGAGAAGGTTGACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-4979s1c1
Sequence:CCGGGCTGCAACCTATGAAAGGTTTCTCGAGAAACCTTTCATAGGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015058.1-326s1c1
Sequence:CCGGGCTCAATCTGTAGTTCAGCATCTCGAGATGCTGAACTACAGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1522s1c1
Sequence:CCGGGCAGAGATACACCCTTCCAAACTCGAGTTTGGAAGGGTGTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-695s1c1
Sequence:CCGGGCTGAGCGTTACGACAAACTTCTCGAGAAGTTTGTCGTAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015058
VWA8 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-5727s1c1
Sequence:CCGGCCAAGGATATCCCTCAGATTTCTCGAGAAATCTGAGGGATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1296s1c1
Sequence:CCGGCCAGGCTATTAAGTCAACCTTCTCGAGAAGGTTGACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-4979s1c1
Sequence:CCGGGCTGCAACCTATGAAAGGTTTCTCGAGAAACCTTTCATAGGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015058.1-326s1c1
Sequence:CCGGGCTCAATCTGTAGTTCAGCATCTCGAGATGCTGAACTACAGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1522s1c1
Sequence:CCGGGCAGAGATACACCCTTCCAAACTCGAGTTTGGAAGGGTGTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-695s1c1
Sequence:CCGGGCTGAGCGTTACGACAAACTTCTCGAGAAGTTTGTCGTAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015058
VWA8 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-5727s1c1
Sequence:CCGGCCAAGGATATCCCTCAGATTTCTCGAGAAATCTGAGGGATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1296s1c1
Sequence:CCGGCCAGGCTATTAAGTCAACCTTCTCGAGAAGGTTGACTTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-4979s1c1
Sequence:CCGGGCTGCAACCTATGAAAGGTTTCTCGAGAAACCTTTCATAGGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015058.1-326s1c1
Sequence:CCGGGCTCAATCTGTAGTTCAGCATCTCGAGATGCTGAACTACAGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-1522s1c1
Sequence:CCGGGCAGAGATACACCCTTCCAAACTCGAGTTTGGAAGGGTGTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015058.1-695s1c1
Sequence:CCGGGCTGAGCGTTACGACAAACTTCTCGAGAAGTTTGTCGTAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173758
VALIDATED
VWA8 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2419s21c1
Sequence:CCGGCCTTGGCGAACACTTACTATTCTCGAGAATAGTAAGTGTTCGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3262s21c1
Sequence:CCGGCTGACTCTTAGACGCTGATAGCTCGAGCTATCAGCGTCTAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3009s21c1
Sequence:CCGGGGATTATCAACTACCCTTATTCTCGAGAATAAGGGTAGTTGATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3217s21c1
Sequence:CCGGGGAGTAAGGAAACGCACTATTCTCGAGAATAGTGCGTTTCCTTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2612s21c1
Sequence:CCGGGCAGTAAAGTTGGGTCATATTCTCGAGAATATGACCCAACTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173758
VALIDATED
VWA8 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2419s21c1
Sequence:CCGGCCTTGGCGAACACTTACTATTCTCGAGAATAGTAAGTGTTCGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3262s21c1
Sequence:CCGGCTGACTCTTAGACGCTGATAGCTCGAGCTATCAGCGTCTAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3009s21c1
Sequence:CCGGGGATTATCAACTACCCTTATTCTCGAGAATAAGGGTAGTTGATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3217s21c1
Sequence:CCGGGGAGTAAGGAAACGCACTATTCTCGAGAATAGTGCGTTTCCTTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2612s21c1
Sequence:CCGGGCAGTAAAGTTGGGTCATATTCTCGAGAATATGACCCAACTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173758
VALIDATED
VWA8 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2419s21c1
Sequence:CCGGCCTTGGCGAACACTTACTATTCTCGAGAATAGTAAGTGTTCGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3262s21c1
Sequence:CCGGCTGACTCTTAGACGCTGATAGCTCGAGCTATCAGCGTCTAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3009s21c1
Sequence:CCGGGGATTATCAACTACCCTTATTCTCGAGAATAAGGGTAGTTGATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-3217s21c1
Sequence:CCGGGGAGTAAGGAAACGCACTATTCTCGAGAATAGTGCGTTTCCTTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_173758.3-2612s21c1
Sequence:CCGGGCAGTAAAGTTGGGTCATATTCTCGAGAATATGACCCAACTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks