EMAIL THIS PAGE TO A FRIEND

VWA9

von Willebrand factor A domain containing 9

Synonyms: C15orf44
UniProtKB ID: Q96SY0, B4DDI6, B4DVD5, Q49AH8, Q96HX5, Q9H0S5
Gene ID:
Mouse(69882) von Willebrand factor A domain containing 9
Rat(300782) von Willebrand factor A domain containing 9
Zebrafish(327593) von Willebrand factor A domain containing 9
dog(487606) von Willebrand factor A domain containing 9
domestic cat(101083518) von Willebrand factor A domain containing 9
domestic guinea pig(100714360) von Willebrand factor A domain containing 9
naked mole-rat(101719870) von Willebrand factor A domain containing 9
cow(534159) von Willebrand factor A domain containing 9
sheep(101121097) von Willebrand factor A domain containing 9
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030800 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030800 Rosetta Predictions human pricing
NM_001007663 Rosetta Predictions rat pricing
NM_001077631 Rosetta Predictions mouse pricing
NM_175153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172627 predicted 1150
2 SASI_Hs01_00172628 predicted 1952
3 SASI_Hs01_00172629 predicted 342
4 SASI_Hs01_00172630 predicted 454
5 SASI_Hs02_00358361 predicted 429
6 SASI_Hs01_00172631 predicted 1163
7 SASI_Hs01_00172632 predicted 991
8 SASI_Hs01_00172633 predicted 830
9 SASI_Hs01_00172634 predicted 1050
10 SASI_Hs01_00172635 predicted 1372
11 SASI_Hs01_00172626 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048585 predicted 1167
2 SASI_Rn01_00048586 predicted 492
3 SASI_Rn01_00048587 predicted 1545
4 SASI_Rn01_00048588 predicted 1830
5 SASI_Rn01_00048590 predicted 1701
6 SASI_Rn01_00048591 predicted 1938
7 SASI_Rn01_00048592 predicted 1007
8 SASI_Rn01_00048593 predicted 1600
9 SASI_Rn01_00048594 predicted 804
10 SASI_Rn02_00198790 predicted 1926
11 SASI_Rn01_00048589 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292803 predicted 2042
2 SASI_Mm02_00292804 predicted 1807
3 SASI_Mm02_00292805 predicted 1701
4 SASI_Mm02_00292806 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345792 predicted 2253
2 SASI_Mm01_00176496 predicted 2020
3 SASI_Mm01_00176498 predicted 1918
4 SASI_Mm01_00176499 predicted 1922
5 SASI_Mm01_00176497 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030800
VALIDATED
VWA9 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-2243s21c1
Sequence:CCGGTCACCTCTTCCCTCGTTTATACTCGAGTATAAACGAGGGAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-553s21c1
Sequence:CCGGCTACAGGAAGCACTAAGTAATCTCGAGATTACTTAGTGCTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-851s21c1
Sequence:CCGGTTGAACGTCTCATAGATTTAACTCGAGTTAAATCTATGAGACGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030800.1-795s21c1
Sequence:CCGGTATCATGTGCATGGCGAATTTCTCGAGAAATTCGCCATGCACATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-945s21c1
Sequence:CCGGACTGATAGGTTTGGCATATACCTCGAGGTATATGCCAAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-1294s1c1
Sequence:CCGGGAAGGAATGGTAGCGATTGTTCTCGAGAACAATCGCTACCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-432s1c1
Sequence:CCGGCCATGGTTTAACGATGCTGTTCTCGAGAACAGCATCGTTAAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030800.1-2113s1c1
Sequence:CCGGGCTTGGAAGATAGCTGCTGTTCTCGAGAACAGCAGCTATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030800
VALIDATED
VWA9 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-2243s21c1
Sequence:CCGGTCACCTCTTCCCTCGTTTATACTCGAGTATAAACGAGGGAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-553s21c1
Sequence:CCGGCTACAGGAAGCACTAAGTAATCTCGAGATTACTTAGTGCTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-851s21c1
Sequence:CCGGTTGAACGTCTCATAGATTTAACTCGAGTTAAATCTATGAGACGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030800.1-795s21c1
Sequence:CCGGTATCATGTGCATGGCGAATTTCTCGAGAAATTCGCCATGCACATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-945s21c1
Sequence:CCGGACTGATAGGTTTGGCATATACCTCGAGGTATATGCCAAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-1294s1c1
Sequence:CCGGGAAGGAATGGTAGCGATTGTTCTCGAGAACAATCGCTACCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-432s1c1
Sequence:CCGGCCATGGTTTAACGATGCTGTTCTCGAGAACAGCATCGTTAAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030800.1-2113s1c1
Sequence:CCGGGCTTGGAAGATAGCTGCTGTTCTCGAGAACAGCAGCTATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030800
VALIDATED
VWA9 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-2243s21c1
Sequence:CCGGTCACCTCTTCCCTCGTTTATACTCGAGTATAAACGAGGGAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-553s21c1
Sequence:CCGGCTACAGGAAGCACTAAGTAATCTCGAGATTACTTAGTGCTTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-851s21c1
Sequence:CCGGTTGAACGTCTCATAGATTTAACTCGAGTTAAATCTATGAGACGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030800.1-795s21c1
Sequence:CCGGTATCATGTGCATGGCGAATTTCTCGAGAAATTCGCCATGCACATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_030800.1-945s21c1
Sequence:CCGGACTGATAGGTTTGGCATATACCTCGAGGTATATGCCAAACCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-1294s1c1
Sequence:CCGGGAAGGAATGGTAGCGATTGTTCTCGAGAACAATCGCTACCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030800.1-432s1c1
Sequence:CCGGCCATGGTTTAACGATGCTGTTCTCGAGAACAGCATCGTTAAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030800.1-2113s1c1
Sequence:CCGGGCTTGGAAGATAGCTGCTGTTCTCGAGAACAGCAGCTATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175153
VALIDATED
VWA9 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor A domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1380s1c1
Sequence:CCGGCCCTTTGTTATAGATGAAGAACTCGAGTTCTTCATCTATAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1121s1c1
Sequence:CCGGCCCTTTCCCATCTAAGTTATACTCGAGTATAACTTAGATGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1197s1c1
Sequence:CCGGCTTGAACGACTCATAGACATACTCGAGTATGTCTATGAGTCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-2506s1c1
Sequence:CCGGCGACTCTTCATGTCTCAATTACTCGAGTAATTGAGACATGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175153.2-1127s1c1
Sequence:CCGGCCCATCTAAGTTATATGTCATCTCGAGATGACATATAACTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175153
VALIDATED
VWA9 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor A domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1380s1c1
Sequence:CCGGCCCTTTGTTATAGATGAAGAACTCGAGTTCTTCATCTATAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1121s1c1
Sequence:CCGGCCCTTTCCCATCTAAGTTATACTCGAGTATAACTTAGATGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1197s1c1
Sequence:CCGGCTTGAACGACTCATAGACATACTCGAGTATGTCTATGAGTCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-2506s1c1
Sequence:CCGGCGACTCTTCATGTCTCAATTACTCGAGTAATTGAGACATGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175153.2-1127s1c1
Sequence:CCGGCCCATCTAAGTTATATGTCATCTCGAGATGACATATAACTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175153
VALIDATED
VWA9 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor A domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1380s1c1
Sequence:CCGGCCCTTTGTTATAGATGAAGAACTCGAGTTCTTCATCTATAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1121s1c1
Sequence:CCGGCCCTTTCCCATCTAAGTTATACTCGAGTATAACTTAGATGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-1197s1c1
Sequence:CCGGCTTGAACGACTCATAGACATACTCGAGTATGTCTATGAGTCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175153.2-2506s1c1
Sequence:CCGGCGACTCTTCATGTCTCAATTACTCGAGTAATTGAGACATGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175153.2-1127s1c1
Sequence:CCGGCCCATCTAAGTTATATGTCATCTCGAGATGACATATAACTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks