EMAIL THIS PAGE TO A FRIEND

VWC2

von Willebrand factor C domain containing 2

Synonyms: PSST739 UNQ739
UniProtKB ID: Q2TAL6, Q6UXE2
Gene ID:
Human(375567) Summary: This gene encodes a secreted bone morphogenic protein antagonist. The encoded protein is possibly involved in neural function and development and may have a role in cell adhesion.[provided by RefSeq, Oct 2009]
Mouse(319922) von Willebrand factor C domain containing 2
Rat(501231) von Willebrand factor C domain containing 2
cow(784924) von Willebrand factor C domain containing 2
sheep(101111796) von Willebrand factor C domain containing 2
naked mole-rat(101708844) von Willebrand factor C domain containing 2
domestic guinea pig(100732904) von Willebrand factor C domain containing 2
Zebrafish(798521) von Willebrand factor C domain containing 2
chicken(420944) von Willebrand factor C domain containing 2
domestic cat(101084943) von Willebrand factor C domain containing 2
dog(483230) von Willebrand factor C domain containing 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055243 Anti-VWC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1292 Human Brorin ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198570 Rosetta Predictions human pricing
NM_001109312 Rosetta Predictions rat pricing
NM_177033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088584 predicted 1435
2 SASI_Hs01_00088585 predicted 1595
3 SASI_Hs01_00088586 predicted 1578
4 SASI_Hs01_00088587 predicted 1448
5 SASI_Hs01_00088588 predicted 1344
6 SASI_Hs01_00088589 predicted 1338
7 SASI_Hs01_00088590 predicted 1502
8 SASI_Hs02_00372203 predicted 1405
9 SASI_Hs01_00088592 predicted 1499
10 SASI_Hs01_00088593 predicted 1240
11 SASI_Hs01_00088591 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247184 predicted 1593
2 SASI_Rn02_00247185 predicted 1553
3 SASI_Rn02_00247186 predicted 1288
4 SASI_Rn02_00247187 predicted 1301
5 SASI_Rn02_00247188 predicted 1638
6 SASI_Rn02_00247189 predicted 1377
7 SASI_Rn02_00247190 predicted 1126
8 SASI_Rn02_00247191 predicted 1591
9 SASI_Rn02_00247192 predicted 1472
10 SASI_Rn02_00247193 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069248 predicted 1563
2 SASI_Mm01_00069249 predicted 1476
3 SASI_Mm01_00069250 predicted 1442
4 SASI_Mm01_00069251 predicted 1484
5 SASI_Mm01_00069252 predicted 1280
6 SASI_Mm01_00069254 predicted 1660
7 SASI_Mm01_00069255 predicted 1555
8 SASI_Mm01_00069257 predicted 980
9 SASI_Mm02_00346994 predicted 1515
10 SASI_Mm02_00346995 predicted 1561
11 SASI_Mm01_00069253 predicted 1383
12 SASI_Mm01_00069256 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177033
VWC2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000098021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1019s1c1
Sequence:CCGGGCACCATATGTCACTGCACTTCTCGAGAAGTGCAGTGACATATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-768s1c1
Sequence:CCGGGAAGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177033.2-1765s1c1
Sequence:CCGGCCTGTGATTCTCTAATGAGAACTCGAGTTCTCATTAGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1082s1c1
Sequence:CCGGCGAGACATGAGTGCAGACAAACTCGAGTTTGTCTGCACTCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177033
VWC2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000098021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1019s1c1
Sequence:CCGGGCACCATATGTCACTGCACTTCTCGAGAAGTGCAGTGACATATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-768s1c1
Sequence:CCGGGAAGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177033.2-1765s1c1
Sequence:CCGGCCTGTGATTCTCTAATGAGAACTCGAGTTCTCATTAGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1082s1c1
Sequence:CCGGCGAGACATGAGTGCAGACAAACTCGAGTTTGTCTGCACTCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177033
VWC2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000098021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1019s1c1
Sequence:CCGGGCACCATATGTCACTGCACTTCTCGAGAAGTGCAGTGACATATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-768s1c1
Sequence:CCGGGAAGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177033.2-1765s1c1
Sequence:CCGGCCTGTGATTCTCTAATGAGAACTCGAGTTCTCATTAGAGAATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177033.2-1082s1c1
Sequence:CCGGCGAGACATGAGTGCAGACAAACTCGAGTTTGTCTGCACTCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198570
VWC2 MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1524s1c1
Sequence:CCGGCCATGTGCACGAGACATGAATCTCGAGATTCATGTCTCGTGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1447s1c1
Sequence:CCGGCAGAGAAGTGAAGACTGACGACTCGAGTCGTCAGTCTTCACTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1567s1c1
Sequence:CCGGCAGAACACAAACTCTGACTTTCTCGAGAAAGTCAGAGTTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1744s1c1
Sequence:CCGGCAACAAGAACTTTGGGCATAACTCGAGTTATGCCCAAAGTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1474s1c1
Sequence:CCGGCATATGCCACTGTACTTATGACTCGAGTCATAAGTACAGTGGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1470s1c1
Sequence:CCGGGCACCATATGCCACTGTACTTCTCGAGAAGTACAGTGGCATATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1219s1c1
Sequence:CCGGGAGGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1533s1c1
Sequence:CCGGCGAGACATGAATGCAGGCAAACTCGAGTTTGCCTGCATTCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1577s21c1
Sequence:CCGGTACTGATGTGAACATTCTAGACTCGAGTCTAGAATGTTCACATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198570.3-1220s21c1
Sequence:CCGGGGCAAGACCTATCAGACTTTGCTCGAGCAAAGTCTGATAGGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1672s21c1
Sequence:CCGGTTGATAACAGTTACTACAACACTCGAGTGTTGTAGTAACTGTTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198570
VWC2 MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1524s1c1
Sequence:CCGGCCATGTGCACGAGACATGAATCTCGAGATTCATGTCTCGTGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1447s1c1
Sequence:CCGGCAGAGAAGTGAAGACTGACGACTCGAGTCGTCAGTCTTCACTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1567s1c1
Sequence:CCGGCAGAACACAAACTCTGACTTTCTCGAGAAAGTCAGAGTTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1744s1c1
Sequence:CCGGCAACAAGAACTTTGGGCATAACTCGAGTTATGCCCAAAGTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1474s1c1
Sequence:CCGGCATATGCCACTGTACTTATGACTCGAGTCATAAGTACAGTGGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1470s1c1
Sequence:CCGGGCACCATATGCCACTGTACTTCTCGAGAAGTACAGTGGCATATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1219s1c1
Sequence:CCGGGAGGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1533s1c1
Sequence:CCGGCGAGACATGAATGCAGGCAAACTCGAGTTTGCCTGCATTCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1577s21c1
Sequence:CCGGTACTGATGTGAACATTCTAGACTCGAGTCTAGAATGTTCACATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198570.3-1220s21c1
Sequence:CCGGGGCAAGACCTATCAGACTTTGCTCGAGCAAAGTCTGATAGGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1672s21c1
Sequence:CCGGTTGATAACAGTTACTACAACACTCGAGTGTTGTAGTAACTGTTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198570
VWC2 MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1524s1c1
Sequence:CCGGCCATGTGCACGAGACATGAATCTCGAGATTCATGTCTCGTGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1447s1c1
Sequence:CCGGCAGAGAAGTGAAGACTGACGACTCGAGTCGTCAGTCTTCACTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1567s1c1
Sequence:CCGGCAGAACACAAACTCTGACTTTCTCGAGAAAGTCAGAGTTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198570.1-1744s1c1
Sequence:CCGGCAACAAGAACTTTGGGCATAACTCGAGTTATGCCCAAAGTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198570.1-1474s1c1
Sequence:CCGGCATATGCCACTGTACTTATGACTCGAGTCATAAGTACAGTGGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1470s1c1
Sequence:CCGGGCACCATATGCCACTGTACTTCTCGAGAAGTACAGTGGCATATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1219s1c1
Sequence:CCGGGAGGAAGAACTACTGCGAGTTCTCGAGAACTCGCAGTAGTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198570.1-1533s1c1
Sequence:CCGGCGAGACATGAATGCAGGCAAACTCGAGTTTGCCTGCATTCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1577s21c1
Sequence:CCGGTACTGATGTGAACATTCTAGACTCGAGTCTAGAATGTTCACATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198570.3-1220s21c1
Sequence:CCGGGGCAAGACCTATCAGACTTTGCTCGAGCAAAGTCTGATAGGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198570.3-1672s21c1
Sequence:CCGGTTGATAACAGTTACTACAACACTCGAGTGTTGTAGTAACTGTTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks