EMAIL THIS PAGE TO A FRIEND

VWC2L

von Willebrand factor C domain containing protein 2-like

UniProtKB ID: B2RUY7, A6NC69, B2RUW7, B7X8X1
Gene ID:
Mouse(320460) von Willebrand factor C domain-containing protein 2-like
Rat(501160) von Willebrand factor C domain-containing protein 2-like
Zebrafish(100148652) von Willebrand factor C domain-containing protein 2-like
chicken(428995) von Willebrand factor C domain containing protein 2-like
domestic cat(101080473) von Willebrand factor C domain containing protein 2-like
dog(488512) von Willebrand factor C domain containing protein 2-like
domestic guinea pig(100731584) von Willebrand factor C domain containing protein 2-like
naked mole-rat(101723005) von Willebrand factor C domain containing protein 2-like
cow(782360) von Willebrand factor C domain containing protein 2-like
sheep(101104637) von Willebrand factor C domain containing protein 2-like
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080500 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080500 Rosetta Predictions human pricing
XM_377783 Rosetta Predictions human pricing
NM_001109308 Rosetta Predictions rat pricing
NM_177164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315437 predicted 583
2 SASI_Hs02_00315438 predicted 361
3 SASI_Hs02_00315439 predicted 837
4 SASI_Hs02_00315440 predicted 411
5 SASI_Hs02_00315441 predicted 856
6 SASI_Hs02_00315442 predicted 576
7 SASI_Hs02_00315443 predicted 401
8 SASI_Hs02_00315444 predicted 772
9 SASI_Hs02_00315445 predicted 480
10 SASI_Hs02_00315446 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_377783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276015 predicted 292
2 SASI_Hs01_00276016 predicted 266
3 SASI_Hs01_00276017 predicted 289
4 SASI_Hs01_00276018 predicted 257
5 SASI_Hs01_00276019 predicted 316
6 SASI_Hs01_00276020 predicted 241
7 SASI_Hs01_00276021 predicted 246
8 SASI_Hs01_00276022 predicted 252
9 SASI_Hs01_00276023 predicted 267
10 SASI_Hs01_00276024 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247144 predicted 1073
2 SASI_Rn02_00247145 predicted 1046
3 SASI_Rn02_00247146 predicted 835
4 SASI_Rn02_00247147 predicted 668
5 SASI_Rn02_00247148 predicted 1057
6 SASI_Rn02_00247149 predicted 725
7 SASI_Rn02_00247150 predicted 1040
8 SASI_Rn02_00247151 predicted 804
9 SASI_Rn02_00247152 predicted 630
10 SASI_Rn02_00247153 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080825 predicted 1383
2 SASI_Mm01_00080827 predicted 1354
3 SASI_Mm01_00080828 predicted 913
4 SASI_Mm01_00080829 predicted 879
5 SASI_Mm02_00347156 predicted 1276
6 SASI_Mm01_00080830 predicted 818
7 SASI_Mm01_00080831 predicted 986
8 SASI_Mm01_00080832 predicted 960
9 SASI_Mm01_00080833 predicted 1277
10 SASI_Mm01_00080834 predicted 1103
11 SASI_Mm01_00080826 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080500
VWC2L MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C domain containing protein 2-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-230s21c1
Sequence:CCGGGGTGACCAGATCTCCAGTAATCTCGAGATTACTGGAGATCTGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-408s21c1
Sequence:CCGGTTCACCCAAAGTGTACTAAAGCTCGAGCTTTAGTACACTTTGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-386s21c1
Sequence:CCGGGACCAACCAGAATGCCCTAAACTCGAGTTTAGGGCATTCTGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-663s21c1
Sequence:CCGGTTGCAGGAACGACGATAATTCCTCGAGGAATTATCGTCGTTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-311s21c1
Sequence:CCGGTACAAGTTGGGAGAACGATTTCTCGAGAAATCGTTCTCCCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080500
VWC2L MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C domain containing protein 2-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-230s21c1
Sequence:CCGGGGTGACCAGATCTCCAGTAATCTCGAGATTACTGGAGATCTGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-408s21c1
Sequence:CCGGTTCACCCAAAGTGTACTAAAGCTCGAGCTTTAGTACACTTTGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-386s21c1
Sequence:CCGGGACCAACCAGAATGCCCTAAACTCGAGTTTAGGGCATTCTGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-663s21c1
Sequence:CCGGTTGCAGGAACGACGATAATTCCTCGAGGAATTATCGTCGTTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-311s21c1
Sequence:CCGGTACAAGTTGGGAGAACGATTTCTCGAGAAATCGTTCTCCCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080500
VWC2L MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C domain containing protein 2-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-230s21c1
Sequence:CCGGGGTGACCAGATCTCCAGTAATCTCGAGATTACTGGAGATCTGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-408s21c1
Sequence:CCGGTTCACCCAAAGTGTACTAAAGCTCGAGCTTTAGTACACTTTGGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-386s21c1
Sequence:CCGGGACCAACCAGAATGCCCTAAACTCGAGTTTAGGGCATTCTGGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-663s21c1
Sequence:CCGGTTGCAGGAACGACGATAATTCCTCGAGGAATTATCGTCGTTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080500.2-311s21c1
Sequence:CCGGTACAAGTTGGGAGAACGATTTCTCGAGAAATCGTTCTCCCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177164
VWC2L MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C domain containing protein 2-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.3-3840s1c1
Sequence:CCGGCTAGACCCTTCTCTATTATTACTCGAGTAATAATAGAGAAGGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.2-3258s1c1
Sequence:CCGGCCTGTTTCTTAATACCACTTTCTCGAGAAAGTGGTATTAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-844s1c1
Sequence:CCGGCACGAAGACTATCCTGCTGATCTCGAGATCAGCAGGATAGTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-883s1c1
Sequence:CCGGCAGTAATGACAATCTGATCTTCTCGAGAAGATCAGATTGTCATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1062s1c1
Sequence:CCGGCAAAGGTGGAACACAATGGATCTCGAGATCCATTGTGTTCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-901s1c1
Sequence:CCGGCTTTGATGACTATCGAGGGAACTCGAGTTCCCTCGATAGTCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-847s1c1
Sequence:CCGGGAAGACTATCCTGCTGATGAACTCGAGTTCATCAGCAGGATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1052s1c1
Sequence:CCGGCCGAAATGTACAAAGGTGGAACTCGAGTTCCACCTTTGTACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-835s1c1
Sequence:CCGGGCCATCAGTCACGAAGACTATCTCGAGATAGTCTTCGTGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177164
VWC2L MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C domain containing protein 2-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.3-3840s1c1
Sequence:CCGGCTAGACCCTTCTCTATTATTACTCGAGTAATAATAGAGAAGGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.2-3258s1c1
Sequence:CCGGCCTGTTTCTTAATACCACTTTCTCGAGAAAGTGGTATTAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-844s1c1
Sequence:CCGGCACGAAGACTATCCTGCTGATCTCGAGATCAGCAGGATAGTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-883s1c1
Sequence:CCGGCAGTAATGACAATCTGATCTTCTCGAGAAGATCAGATTGTCATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1062s1c1
Sequence:CCGGCAAAGGTGGAACACAATGGATCTCGAGATCCATTGTGTTCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-901s1c1
Sequence:CCGGCTTTGATGACTATCGAGGGAACTCGAGTTCCCTCGATAGTCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-847s1c1
Sequence:CCGGGAAGACTATCCTGCTGATGAACTCGAGTTCATCAGCAGGATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1052s1c1
Sequence:CCGGCCGAAATGTACAAAGGTGGAACTCGAGTTCCACCTTTGTACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-835s1c1
Sequence:CCGGGCCATCAGTCACGAAGACTATCTCGAGATAGTCTTCGTGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177164
VWC2L MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C domain containing protein 2-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.3-3840s1c1
Sequence:CCGGCTAGACCCTTCTCTATTATTACTCGAGTAATAATAGAGAAGGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177164.2-3258s1c1
Sequence:CCGGCCTGTTTCTTAATACCACTTTCTCGAGAAAGTGGTATTAAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-844s1c1
Sequence:CCGGCACGAAGACTATCCTGCTGATCTCGAGATCAGCAGGATAGTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-883s1c1
Sequence:CCGGCAGTAATGACAATCTGATCTTCTCGAGAAGATCAGATTGTCATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1062s1c1
Sequence:CCGGCAAAGGTGGAACACAATGGATCTCGAGATCCATTGTGTTCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-901s1c1
Sequence:CCGGCTTTGATGACTATCGAGGGAACTCGAGTTCCCTCGATAGTCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-847s1c1
Sequence:CCGGGAAGACTATCCTGCTGATGAACTCGAGTTCATCAGCAGGATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177164.2-1052s1c1
Sequence:CCGGCCGAAATGTACAAAGGTGGAACTCGAGTTCCACCTTTGTACATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177164.2-835s1c1
Sequence:CCGGGCCATCAGTCACGAAGACTATCTCGAGATAGTCTTCGTGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks