EMAIL THIS PAGE TO A FRIEND

VWCE

von Willebrand factor C and EGF domains

Synonyms: URG11 VWC1
UniProtKB ID: Q96DN2, A5PKV0, Q7Z7L6, Q86WK8
Gene ID:
Mouse(71768) von Willebrand factor C and EGF domains
Rat(309209) von Willebrand factor C and EGF domains
chicken(101664942) von Willebrand factor C and EGF domains
Horse(100059568) von Willebrand factor C and EGF domains
domestic cat(101083799) von Willebrand factor C and EGF domains
dog(483801) von Willebrand factor C and EGF domains
chicken(101748485) von Willebrand factor C and EGF domains
cow(787487) von Willebrand factor C and EGF domains
sheep(101109135) von Willebrand factor C and EGF domains
naked mole-rat(101713001) von Willebrand factor C and EGF domains
Domestic Rabbit(100344438) von Willebrand factor C and EGF domains
domestic guinea pig(100727479) von Willebrand factor C and EGF domains
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152718 Rosetta Predictions human pricing
XM_001074809 Rosetta Predictions rat pricing
XM_219579 Rosetta Predictions rat pricing
XM_889279 Rosetta Predictions mouse pricing
XM_915264 Rosetta Predictions mouse pricing
XM_986009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182412 predicted 2545
2 SASI_Hs01_00182413 predicted 695
3 SASI_Hs01_00182414 predicted 700
4 SASI_Hs01_00182415 predicted 1832
5 SASI_Hs01_00182416 predicted 694
6 SASI_Hs01_00182417 predicted 1054
7 SASI_Hs01_00182418 predicted 2329
8 SASI_Hs01_00182419 predicted 1121
9 SASI_Hs01_00182420 predicted 1682
10 SASI_Hs01_00182421 predicted 2548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347406 predicted 446
2 SASI_Rn02_00347407 predicted 2855
3 SASI_Rn02_00347408 predicted 487
4 SASI_Rn02_00347409 predicted 2037
5 SASI_Rn02_00347410 predicted 1398
6 SASI_Rn02_00347411 predicted 1241
7 SASI_Rn02_00347412 predicted 2615
8 SASI_Rn02_00347413 predicted 2565
9 SASI_Rn02_00347414 predicted 2905
10 SASI_Rn02_00347415 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378565 predicted 452
2 SASI_Rn02_00378566 predicted 2855
3 SASI_Rn02_00378567 predicted 484
4 SASI_Rn02_00378568 predicted 2040
5 SASI_Rn02_00378569 predicted 1401
6 SASI_Rn02_00378570 predicted 1244
7 SASI_Rn02_00378571 predicted 2612
8 SASI_Rn02_00378572 predicted 2565
9 SASI_Rn02_00378573 predicted 2909
10 SASI_Rn02_00378574 predicted 2071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259561 predicted 668
2 SASI_Mm02_00428765 predicted 796
3 SASI_Mm02_00428766 predicted 746
4 SASI_Mm01_00259563 predicted 263
5 SASI_Mm02_00428767 predicted 326
6 SASI_Mm02_00428768 predicted 1003
7 SASI_Mm02_00428769 predicted 1069
8 SASI_Mm02_00428770 predicted 875
9 SASI_Mm02_00428771 predicted 737
10 SASI_Mm02_00428772 predicted 599
11 SASI_Mm01_00259562 predicted 605
12 SASI_Mm01_00259564 predicted 3117
13 SASI_Mm01_00259565 predicted 3129
14 SASI_Mm01_00259566 predicted 2877
15 SASI_Mm01_00259567 predicted 2753
16 SASI_Mm01_00259568 predicted 555
17 SASI_Mm01_00259569 predicted 3018
18 SASI_Mm01_00259570 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439301 predicted 672
2 SASI_Mm02_00439302 predicted 2254
3 SASI_Mm02_00439303 predicted 663
4 SASI_Mm02_00439304 predicted 1460
5 SASI_Mm02_00439305 predicted 2411
6 SASI_Mm02_00439306 predicted 260
7 SASI_Mm02_00439307 predicted 1677
8 SASI_Mm02_00439308 predicted 1620
9 SASI_Mm02_00439309 predicted 3125
10 SASI_Mm02_00439310 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276200 predicted 265
2 SASI_Mm01_00276201 predicted 326
3 SASI_Mm01_00276202 predicted 242
4 SASI_Mm01_00276203 predicted 330
5 SASI_Mm01_00276204 predicted 297
6 SASI_Mm01_00276205 predicted 304
7 SASI_Mm01_00276206 predicted 242
8 SASI_Mm01_00276207 predicted 251
9 SASI_Mm01_00276208 predicted 249
10 SASI_Mm01_00276209 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152718
VWCE MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C and EGF domains
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152718.1-3079s1c1
Sequence:CCGGGTTTGGAATGTGCTGTAAGAACTCGAGTTCTTACAGCACATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-636s1c1
Sequence:CCGGGCTACAAGTGTTCCTGTCGAACTCGAGTTCGACAGGAACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-877s1c1
Sequence:CCGGCCCGTCCAAGATGCTTCTGTTCTCGAGAACAGAAGCATCTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-1930s1c1
Sequence:CCGGCACAGGCAGAATCTTCTATAACTCGAGTTATAGAAGATTCTGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-2038s1c1
Sequence:CCGGCATCACCTGTACCTACCCTTTCTCGAGAAAGGGTAGGTACAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152718
VWCE MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C and EGF domains
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152718.1-3079s1c1
Sequence:CCGGGTTTGGAATGTGCTGTAAGAACTCGAGTTCTTACAGCACATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-636s1c1
Sequence:CCGGGCTACAAGTGTTCCTGTCGAACTCGAGTTCGACAGGAACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-877s1c1
Sequence:CCGGCCCGTCCAAGATGCTTCTGTTCTCGAGAACAGAAGCATCTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-1930s1c1
Sequence:CCGGCACAGGCAGAATCTTCTATAACTCGAGTTATAGAAGATTCTGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-2038s1c1
Sequence:CCGGCATCACCTGTACCTACCCTTTCTCGAGAAAGGGTAGGTACAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152718
VWCE MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C and EGF domains
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152718.1-3079s1c1
Sequence:CCGGGTTTGGAATGTGCTGTAAGAACTCGAGTTCTTACAGCACATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-636s1c1
Sequence:CCGGGCTACAAGTGTTCCTGTCGAACTCGAGTTCGACAGGAACACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-877s1c1
Sequence:CCGGCCCGTCCAAGATGCTTCTGTTCTCGAGAACAGAAGCATCTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-1930s1c1
Sequence:CCGGCACAGGCAGAATCTTCTATAACTCGAGTTATAGAAGATTCTGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152718.1-2038s1c1
Sequence:CCGGCATCACCTGTACCTACCCTTTCTCGAGAAAGGGTAGGTACAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027913
VWCE MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor C and EGF domains
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-878s21c1
Sequence:CCGGGGCAACCGACACTCCTGTATACTCGAGTATACAGGAGTGTCGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027913.1-3146s21c1
Sequence:CCGGGTAAGATGGTTCATCTATAAACTCGAGTTTATAGATGAACCATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-662s21c1
Sequence:CCGGGCGGACATTGACGAGTGTTTACTCGAGTAAACACTCGTCAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-826s21c1
Sequence:CCGGGAACAGCATTGGTAGCTATAACTCGAGTTATAGCTACCAATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-2595s21c1
Sequence:CCGGGAACAAACCTGTCTAACATACCTCGAGGTATGTTAGACAGGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027913
VWCE MISSION shRNA shRNA Plasmid DNA
von Willebrand factor C and EGF domains
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-878s21c1
Sequence:CCGGGGCAACCGACACTCCTGTATACTCGAGTATACAGGAGTGTCGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027913.1-3146s21c1
Sequence:CCGGGTAAGATGGTTCATCTATAAACTCGAGTTTATAGATGAACCATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-662s21c1
Sequence:CCGGGCGGACATTGACGAGTGTTTACTCGAGTAAACACTCGTCAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-826s21c1
Sequence:CCGGGAACAGCATTGGTAGCTATAACTCGAGTTATAGCTACCAATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-2595s21c1
Sequence:CCGGGAACAAACCTGTCTAACATACCTCGAGGTATGTTAGACAGGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027913
VWCE MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor C and EGF domains
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-878s21c1
Sequence:CCGGGGCAACCGACACTCCTGTATACTCGAGTATACAGGAGTGTCGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027913.1-3146s21c1
Sequence:CCGGGTAAGATGGTTCATCTATAAACTCGAGTTTATAGATGAACCATCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-662s21c1
Sequence:CCGGGCGGACATTGACGAGTGTTTACTCGAGTAAACACTCGTCAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-826s21c1
Sequence:CCGGGAACAGCATTGGTAGCTATAACTCGAGTTATAGCTACCAATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027913.1-2595s21c1
Sequence:CCGGGAACAAACCTGTCTAACATACCTCGAGGTATGTTAGACAGGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks