EMAIL THIS PAGE TO A FRIEND

VWDE

von Willebrand factor D and EGF domains

UniProtKB ID: Q8N2E2, Q96SQ3
Gene ID:
Mouse(232585) von Willebrand factor D and EGF domains
Rat(502731) von Willebrand factor D and EGF domains
domestic guinea pig(100729111) von Willebrand factor D and EGF domains
naked mole-rat(101715551) von Willebrand factor D and EGF domains
cow(100301009) von Willebrand factor D and EGF domains
sheep(101117158) von Willebrand factor D and EGF domains
Zebrafish(767804) von Willebrand factor D and EGF domains
chicken(420587) von Willebrand factor D and EGF domains
Horse(100065013) von Willebrand factor D and EGF domains
domestic cat(101081282) von Willebrand factor D and EGF domains
dog(482323) von Willebrand factor D and EGF domain-containing protein-like
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001135924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715460 Rosetta Predictions human pricing
XM_371878 Rosetta Predictions human pricing
XM_374405 Rosetta Predictions human pricing
XM_936911 Rosetta Predictions human pricing
XM_001057162 Rosetta Predictions rat pricing
XM_578230 Rosetta Predictions rat pricing
NM_001013757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403863 predicted 3969
2 SASI_Hs02_00403864 predicted 5261
3 SASI_Hs02_00403865 predicted 3983
4 SASI_Hs02_00403866 predicted 4794
5 SASI_Hs02_00403867 predicted 1914
6 SASI_Hs02_00403868 predicted 3564
7 SASI_Hs02_00403869 predicted 1386
8 SASI_Hs02_00403870 predicted 2049
9 SASI_Hs02_00403871 predicted 1336
10 SASI_Hs02_00403872 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300834 predicted 3970
2 SASI_Hs01_00300835 predicted 5267
3 SASI_Hs01_00300836 predicted 3991
4 SASI_Hs01_00300837 predicted 4799
5 SASI_Hs01_00300838 predicted 1918
6 SASI_Hs01_00300840 predicted 3562
7 SASI_Hs01_00300841 predicted 1387
8 SASI_Hs02_00479370 predicted 2046
9 SASI_Hs01_00300842 predicted 1341
10 SASI_Hs02_00479371 predicted 4367
11 SASI_Hs01_00300839 predicted 2041
12 SASI_Hs01_00300843 predicted 5299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479665 predicted 3977
2 SASI_Hs02_00479666 predicted 5265
3 SASI_Hs02_00479667 predicted 3983
4 SASI_Hs02_00479668 predicted 4798
5 SASI_Hs02_00479669 predicted 1919
6 SASI_Hs02_00479670 predicted 3556
7 SASI_Hs02_00479671 predicted 1392
8 SASI_Hs02_00479672 predicted 2047
9 SASI_Hs02_00479673 predicted 1343
10 SASI_Hs02_00479674 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482350 predicted 3973
2 SASI_Hs02_00482351 predicted 5260
3 SASI_Hs02_00482352 predicted 3984
4 SASI_Hs02_00482353 predicted 4794
5 SASI_Hs02_00482354 predicted 1922
6 SASI_Hs02_00482355 predicted 3561
7 SASI_Hs02_00482356 predicted 1395
8 SASI_Hs02_00482357 predicted 2052
9 SASI_Hs02_00482358 predicted 1338
10 SASI_Hs02_00482359 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285626 predicted 3722
2 SASI_Rn02_00285627 predicted 3552
3 SASI_Rn02_00285628 predicted 2831
4 SASI_Rn02_00285629 predicted 698
5 SASI_Rn02_00285630 predicted 1229
6 SASI_Rn02_00285631 predicted 2532
7 SASI_Rn02_00285632 predicted 1321
8 SASI_Rn02_00285633 predicted 1002
9 SASI_Rn02_00285634 predicted 1728
10 SASI_Rn02_00285635 predicted 4119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407707 predicted 3727
2 SASI_Rn02_00407708 predicted 3557
3 SASI_Rn02_00407709 predicted 2831
4 SASI_Rn02_00407710 predicted 705
5 SASI_Rn02_00407711 predicted 1237
6 SASI_Rn02_00407712 predicted 2537
7 SASI_Rn02_00407713 predicted 1323
8 SASI_Rn02_00407714 predicted 1006
9 SASI_Rn02_00407715 predicted 1734
10 SASI_Rn02_00407716 predicted 4114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041710 predicted 1659
2 SASI_Mm02_00287287 predicted 2905
3 SASI_Mm01_00041712 predicted 244
4 SASI_Mm01_00041714 predicted 1380
5 SASI_Mm01_00041715 predicted 938
6 SASI_Mm02_00287288 predicted 2119
7 SASI_Mm02_00287289 predicted 2077
8 SASI_Mm02_00287290 predicted 2943
9 SASI_Mm02_00287291 predicted 1807
10 SASI_Mm02_00287292 predicted 2274
11 SASI_Mm01_00041706 predicted 1135
12 SASI_Mm01_00041707 predicted 1147
13 SASI_Mm01_00041708 predicted 1431
14 SASI_Mm01_00041709 predicted 1429
15 SASI_Mm01_00041711 predicted 1455
16 SASI_Mm01_00041713 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013757
VWDE MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor D and EGF domains
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-874s21c1
Sequence:CCGGTTAGAGCTTGATGGCATAAATCTCGAGATTTATGCCATCAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-1873s21c1
Sequence:CCGGATTGATCACGACGACAATTATCTCGAGATAATTGTCGTCGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2103s21c1
Sequence:CCGGCTTGATACCAGACCTAGATATCTCGAGATATCTAGGTCTGGTATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2374s21c1
Sequence:CCGGGACTTTCATCCCGTCTATATTCTCGAGAATATAGACGGGATGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013757
VWDE MISSION shRNA shRNA Plasmid DNA
von Willebrand factor D and EGF domains
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-874s21c1
Sequence:CCGGTTAGAGCTTGATGGCATAAATCTCGAGATTTATGCCATCAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-1873s21c1
Sequence:CCGGATTGATCACGACGACAATTATCTCGAGATAATTGTCGTCGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2103s21c1
Sequence:CCGGCTTGATACCAGACCTAGATATCTCGAGATATCTAGGTCTGGTATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2374s21c1
Sequence:CCGGGACTTTCATCCCGTCTATATTCTCGAGAATATAGACGGGATGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013757
VWDE MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor D and EGF domains
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-874s21c1
Sequence:CCGGTTAGAGCTTGATGGCATAAATCTCGAGATTTATGCCATCAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-1873s21c1
Sequence:CCGGATTGATCACGACGACAATTATCTCGAGATAATTGTCGTCGTGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2103s21c1
Sequence:CCGGCTTGATACCAGACCTAGATATCTCGAGATATCTAGGTCTGGTATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013757.2-2374s21c1
Sequence:CCGGGACTTTCATCCCGTCTATATTCTCGAGAATATAGACGGGATGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135924
VWDE MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor D and EGF domains
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2007s21c1
Sequence:CCGGACGTGAATCACAACCATATTTCTCGAGAAATATGGTTGTGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-3564s21c1
Sequence:CCGGGGTATCTAATGATGGTTATAACTCGAGTTATAACCATCATTAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135924.1-5351s21c1
Sequence:CCGGGGAGATAACTTGGAGTTTATTCTCGAGAATAAACTCCAAGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-1261s21c1
Sequence:CCGGTTAGAACTTGATGGCATAAATCTCGAGATTTATGCCATCAAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2620s21c1
Sequence:CCGGCTGACTAAACTCGGCTTAAATCTCGAGATTTAAGCCGAGTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135924
VWDE MISSION shRNA shRNA Plasmid DNA
von Willebrand factor D and EGF domains
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2007s21c1
Sequence:CCGGACGTGAATCACAACCATATTTCTCGAGAAATATGGTTGTGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-3564s21c1
Sequence:CCGGGGTATCTAATGATGGTTATAACTCGAGTTATAACCATCATTAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135924.1-5351s21c1
Sequence:CCGGGGAGATAACTTGGAGTTTATTCTCGAGAATAAACTCCAAGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-1261s21c1
Sequence:CCGGTTAGAACTTGATGGCATAAATCTCGAGATTTATGCCATCAAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2620s21c1
Sequence:CCGGCTGACTAAACTCGGCTTAAATCTCGAGATTTAAGCCGAGTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135924
VWDE MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor D and EGF domains
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2007s21c1
Sequence:CCGGACGTGAATCACAACCATATTTCTCGAGAAATATGGTTGTGATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-3564s21c1
Sequence:CCGGGGTATCTAATGATGGTTATAACTCGAGTTATAACCATCATTAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135924.1-5351s21c1
Sequence:CCGGGGAGATAACTTGGAGTTTATTCTCGAGAATAAACTCCAAGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-1261s21c1
Sequence:CCGGTTAGAACTTGATGGCATAAATCTCGAGATTTATGCCATCAAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135924.1-2620s21c1
Sequence:CCGGCTGACTAAACTCGGCTTAAATCTCGAGATTTAAGCCGAGTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks