EMAIL THIS PAGE TO A FRIEND

VWF

von Willebrand factor

Synonyms: F8VWF VWD
UniProtKB ID: P04275, Q99806
Gene ID:
Human(7450) Summary: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-vessel wall mediator in the blood coagulation system. It is crucial to the hemostasis process. Mutations in this gene or deficiencies in this protein result in von Willebrand's disease. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(22371) Von Willebrand factor homolog
Rat(116669) von Willebrand factor
Zebrafish(570643) von Willebrand factor
Horse(100059472) von Willebrand factor
domestic cat(493760) von Willebrand factor
dog(399544) von Willebrand factor
chicken(419031) von Willebrand factor
cow(280958) von Willebrand factor
sheep(101110931) von Willebrand factor
naked mole-rat(101696988) von Willebrand factor
Domestic Rabbit(100009165) von Willebrand factor
domestic guinea pig(100732530) von Willebrand factor
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F3520 Anti-von Willebrand Factor antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry pricing
SAB1406590 Anti-VWF antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001815 Anti-VWF antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA002082 Anti-VWF antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1408640 Anti-VWF antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
AMAB90928 Monoclonal Anti-VWF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1950, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90931 Monoclonal Anti-VWF antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1957, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1402960 Monoclonal Anti-VWF antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040071 MISSION® esiRNA esiRNA targeting mouse Vwf (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000552 Rosetta Predictions human pricing
XM_001066203 Rosetta Predictions rat pricing
XM_342759 Rosetta Predictions rat pricing
NM_011708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074013 predicted 445
2 SASI_Hs01_00074014 predicted 8005
3 SASI_Hs02_00302791 predicted 561
4 SASI_Hs02_00302792 predicted 3873
5 SASI_Hs01_00074015 predicted 5498
6 SASI_Hs01_00074016 predicted 6835
7 SASI_Hs01_00074017 predicted 2579
8 SASI_Hs01_00074019 predicted 6245
9 SASI_Hs02_00302793 predicted 5054
10 SASI_Hs01_00074022 predicted 389
11 SASI_Hs01_00074018 predicted 1448
12 SASI_Hs01_00074020 predicted 3484
13 SASI_Hs01_00074021 predicted 7561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316633 predicted 3471
2 SASI_Rn02_00316634 predicted 658
3 SASI_Rn02_00316635 predicted 7160
4 SASI_Rn02_00316636 predicted 7300
5 SASI_Rn02_00316637 predicted 6797
6 SASI_Rn02_00316638 predicted 6518
7 SASI_Rn02_00316639 predicted 6467
8 SASI_Rn02_00316640 predicted 820
9 SASI_Rn02_00316641 predicted 2861
10 SASI_Rn02_00316642 predicted 6669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394751 predicted 3224
2 SASI_Rn02_00394752 predicted 6907
3 SASI_Rn02_00394753 predicted 7052
4 SASI_Rn02_00394754 predicted 7745
5 SASI_Rn02_00394755 predicted 6546
6 SASI_Rn02_00394756 predicted 6266
7 SASI_Rn02_00394757 predicted 2832
8 SASI_Rn02_00394758 predicted 6224
9 SASI_Rn02_00394759 predicted 2605
10 SASI_Rn02_00394760 predicted 6425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133352 predicted 6474
2 SASI_Mm01_00133353 predicted 4854
3 SASI_Mm02_00321271 predicted 366
4 SASI_Mm01_00133354 predicted 3329
5 SASI_Mm02_00321272 predicted 433
6 SASI_Mm01_00133356 predicted 5968
7 SASI_Mm02_00321273 predicted 7995
8 SASI_Mm02_00321274 predicted 6362
9 SASI_Mm01_00133360 predicted 1179
10 SASI_Mm01_00133361 predicted 6144
11 SASI_Mm01_00133355 predicted 5612
12 SASI_Mm01_00133357 predicted 2840
13 SASI_Mm01_00133358 predicted 2040
14 SASI_Mm01_00133359 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000552
VWF MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-6360s21c1
Sequence:CCGGACATGGAAGTCAACGTTTATGCTCGAGCATAAACGTTGACTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-448s21c1
Sequence:CCGGGAAACGCTCCTTCTCGATTATCTCGAGATAATCGAGAAGGAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-2877s21c1
Sequence:CCGGTCACCTTCGACGGGCTCAAATCTCGAGATTTGAGCCCGTCGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-8193s1c1
Sequence:CCGGCCCTGGGTTACAAGGAAGAAACTCGAGTTTCTTCCTTGTAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-5914s1c1
Sequence:CCGGCCACAAACTGTGCTCTGGATTCTCGAGAATCCAGAGCACAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-7021s1c1
Sequence:CCGGCCCTCCAGATAAAGTCATGTTCTCGAGAACATGACTTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-1492s1c1
Sequence:CCGGCCACTTCAAGAGCTTTGACAACTCGAGTTGTCAAAGCTCTTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000552.2-8760s1c1
Sequence:CCGGGCAGCTGCATGGGTGCCTGCTCTCGAGAGCAGGCACCCATGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000552
VWF MISSION shRNA shRNA Plasmid DNA
von Willebrand factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-6360s21c1
Sequence:CCGGACATGGAAGTCAACGTTTATGCTCGAGCATAAACGTTGACTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-448s21c1
Sequence:CCGGGAAACGCTCCTTCTCGATTATCTCGAGATAATCGAGAAGGAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-2877s21c1
Sequence:CCGGTCACCTTCGACGGGCTCAAATCTCGAGATTTGAGCCCGTCGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-8193s1c1
Sequence:CCGGCCCTGGGTTACAAGGAAGAAACTCGAGTTTCTTCCTTGTAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-5914s1c1
Sequence:CCGGCCACAAACTGTGCTCTGGATTCTCGAGAATCCAGAGCACAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-7021s1c1
Sequence:CCGGCCCTCCAGATAAAGTCATGTTCTCGAGAACATGACTTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-1492s1c1
Sequence:CCGGCCACTTCAAGAGCTTTGACAACTCGAGTTGTCAAAGCTCTTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000552.2-8760s1c1
Sequence:CCGGGCAGCTGCATGGGTGCCTGCTCTCGAGAGCAGGCACCCATGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000552
VWF MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-6360s21c1
Sequence:CCGGACATGGAAGTCAACGTTTATGCTCGAGCATAAACGTTGACTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-448s21c1
Sequence:CCGGGAAACGCTCCTTCTCGATTATCTCGAGATAATCGAGAAGGAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000552.3-2877s21c1
Sequence:CCGGTCACCTTCGACGGGCTCAAATCTCGAGATTTGAGCCCGTCGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-8193s1c1
Sequence:CCGGCCCTGGGTTACAAGGAAGAAACTCGAGTTTCTTCCTTGTAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-5914s1c1
Sequence:CCGGCCACAAACTGTGCTCTGGATTCTCGAGAATCCAGAGCACAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-7021s1c1
Sequence:CCGGCCCTCCAGATAAAGTCATGTTCTCGAGAACATGACTTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000552.2-1492s1c1
Sequence:CCGGCCACTTCAAGAGCTTTGACAACTCGAGTTGTCAAAGCTCTTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000552.2-8760s1c1
Sequence:CCGGGCAGCTGCATGGGTGCCTGCTCTCGAGAGCAGGCACCCATGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011708
VWF MISSION shRNA Bacterial Glycerol Stock
von Willebrand factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5334s1c1
Sequence:CCGGGCGCTATGTAACTTCACAAATCTCGAGATTTGTGAAGTTACATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-3949s1c1
Sequence:CCGGGCAGTGGTAGAGTACCATGATCTCGAGATCATGGTACTCTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5106s1c1
Sequence:CCGGGCCAGAGTCTTCCTTTGATAACTCGAGTTATCAAAGGAAGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-4180s1c1
Sequence:CCGGGCTAGGAATTTGGTCCGCTATCTCGAGATAGCGGACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-8079s1c1
Sequence:CCGGCCCACCATTTGATGAACACAACTCGAGTTGTGTTCATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011708
VWF MISSION shRNA shRNA Plasmid DNA
von Willebrand factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5334s1c1
Sequence:CCGGGCGCTATGTAACTTCACAAATCTCGAGATTTGTGAAGTTACATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-3949s1c1
Sequence:CCGGGCAGTGGTAGAGTACCATGATCTCGAGATCATGGTACTCTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5106s1c1
Sequence:CCGGGCCAGAGTCTTCCTTTGATAACTCGAGTTATCAAAGGAAGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-4180s1c1
Sequence:CCGGGCTAGGAATTTGGTCCGCTATCTCGAGATAGCGGACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-8079s1c1
Sequence:CCGGCCCACCATTTGATGAACACAACTCGAGTTGTGTTCATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011708
VWF MISSION shRNA Lentiviral Transduction Particles
von Willebrand factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5334s1c1
Sequence:CCGGGCGCTATGTAACTTCACAAATCTCGAGATTTGTGAAGTTACATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-3949s1c1
Sequence:CCGGGCAGTGGTAGAGTACCATGATCTCGAGATCATGGTACTCTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-5106s1c1
Sequence:CCGGGCCAGAGTCTTCCTTTGATAACTCGAGTTATCAAAGGAAGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-4180s1c1
Sequence:CCGGGCTAGGAATTTGGTCCGCTATCTCGAGATAGCGGACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011708.2-8079s1c1
Sequence:CCGGCCCACCATTTGATGAACACAACTCGAGTTGTGTTCATCAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks