EMAIL THIS PAGE TO A FRIEND

WAC

WW domain containing adaptor with coiled-coil

Synonyms: BM-016 PRO1741 Wwp4
Gene ID:
Human(51322) Summary: The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Mouse(225131) WW domain containing adaptor with coiled-coil
fruit fly(38044) wee Augmin
Horse(100064150) WW domain containing adaptor with coiled-coil
domestic cat(101090115) WW domain containing adaptor with coiled-coil
dog(477962) WW domain containing adaptor with coiled-coil
chicken(428414) WW domain containing adaptor with coiled-coil
cow(532597) WW domain containing adaptor with coiled-coil
sheep(101117863) WW domain containing adaptor with coiled-coil
domestic guinea pig(100722254) WW domain containing adaptor with coiled-coil
naked mole-rat(101704162) WW domain containing adaptor with coiled-coil
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090341 MISSION® esiRNA esiRNA human WAC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016628 Rosetta Predictions human pricing
NM_100264 Rosetta Predictions human pricing
NM_100486 Rosetta Predictions human pricing
NM_153085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066527 predicted 1849
2 SASI_Hs01_00066528 predicted 1365
3 SASI_Hs01_00066529 predicted 2114
4 SASI_Hs01_00066530 predicted 352
5 SASI_Hs01_00066532 predicted 1461
6 SASI_Hs01_00066533 predicted 1650
7 SASI_Hs01_00066534 predicted 1837
8 SASI_Hs01_00066535 predicted 1511
9 SASI_Hs01_00066536 predicted 1956
10 SASI_Hs02_00349792 predicted 1207
11 SASI_Hs01_00066531 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_100264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155049 predicted 1971
2 SASI_Hs01_00155050 predicted 1488
3 SASI_Hs01_00155051 predicted 2228
4 SASI_Hs01_00155052 predicted 473
5 SASI_Hs01_00155054 predicted 1580
6 SASI_Hs01_00155055 predicted 1775
7 SASI_Hs01_00155056 predicted 1960
8 SASI_Hs01_00155057 predicted 1628
9 SASI_Hs01_00155058 predicted 2079
10 SASI_Hs02_00362694 predicted 1331
11 SASI_Hs01_00155053 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_100486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057183 predicted 1540
2 SASI_Hs01_00057184 predicted 1051
3 SASI_Hs01_00057185 predicted 1801
4 SASI_Hs01_00057186 predicted 345
5 SASI_Hs01_00057188 predicted 1154
6 SASI_Hs01_00057189 predicted 1341
7 SASI_Hs01_00057190 predicted 1534
8 SASI_Hs01_00057191 predicted 1196
9 SASI_Hs01_00057192 predicted 1646
10 SASI_Hs02_00362695 predicted 894
11 SASI_Hs01_00057187 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024912 predicted 612
2 SASI_Mm01_00024913 predicted 2360
3 SASI_Mm01_00024914 predicted 767
4 SASI_Mm02_00342919 predicted 1675
5 SASI_Mm01_00024917 predicted 2155
6 SASI_Mm01_00024918 predicted 2093
7 SASI_Mm01_00024919 predicted 1763
8 SASI_Mm01_00024920 predicted 1381
9 SASI_Mm01_00024921 predicted 2109
10 SASI_Mm02_00342920 predicted 1178
11 SASI_Mm01_00024915 predicted 1271
12 SASI_Mm01_00024916 predicted 2302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153085
VALIDATED
WAC MISSION shRNA Bacterial Glycerol Stock
WW domain containing adaptor with coiled-coil
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-1902s1c1
Sequence:CCGGGCATCAAGATTGCGTGAAGAACTCGAGTTCTTCACGCAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-472s1c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-2018s1c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-436s1c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-656s21c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-692s21c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153085.3-2605s21c1
Sequence:CCGGCAATGCTGAGGTGGCTAAATACTCGAGTATTTAGCCACCTCAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2238s21c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2133s21c1
Sequence:CCGGGCGTGAAGAAGCCCATAATATCTCGAGATATTATGGGCTTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153085
VALIDATED
WAC MISSION shRNA shRNA Plasmid DNA
WW domain containing adaptor with coiled-coil
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-1902s1c1
Sequence:CCGGGCATCAAGATTGCGTGAAGAACTCGAGTTCTTCACGCAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-472s1c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-2018s1c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-436s1c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-656s21c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-692s21c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153085.3-2605s21c1
Sequence:CCGGCAATGCTGAGGTGGCTAAATACTCGAGTATTTAGCCACCTCAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2238s21c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2133s21c1
Sequence:CCGGGCGTGAAGAAGCCCATAATATCTCGAGATATTATGGGCTTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153085
VALIDATED
WAC MISSION shRNA Lentiviral Transduction Particles
WW domain containing adaptor with coiled-coil
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-1902s1c1
Sequence:CCGGGCATCAAGATTGCGTGAAGAACTCGAGTTCTTCACGCAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-472s1c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-2018s1c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153085.1-436s1c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-656s21c1
Sequence:CCGGCCAGTTACTCTCCACAAGAAACTCGAGTTTCTTGTGGAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-692s21c1
Sequence:CCGGGTGCACTTCATAGTTCAAATTCTCGAGAATTTGAACTATGAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153085.3-2605s21c1
Sequence:CCGGCAATGCTGAGGTGGCTAAATACTCGAGTATTTAGCCACCTCAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2238s21c1
Sequence:CCGGGCGAGAGCAGAGGATACTATTCTCGAGAATAGTATCCTCTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153085.3-2133s21c1
Sequence:CCGGGCGTGAAGAAGCCCATAATATCTCGAGATATTATGGGCTTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016628
VALIDATED
WAC MISSION shRNA Bacterial Glycerol Stock
WW domain containing adaptor with coiled-coil
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-253s1c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-524s1c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-1448s1c1
Sequence:CCGGCTCAAACTAACACAGTCCCTACTCGAGTAGGGACTGTGTTAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1822s1c1
Sequence:CCGGGCATCAAGATTACGCGAAGAACTCGAGTTCTTCGCGTAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1368s1c1
Sequence:CCGGGCCATCTAATCAGTCTCCGATCTCGAGATCGGAGACTGATTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016628.2-2725s1c1
Sequence:CCGGGCAGTGATTGAGCATAACCTACTCGAGTAGGTTATGCTCAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-534s21c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1869s21c1
Sequence:CCGGCTATTCACATGTCCGAAATTTCTCGAGAAATTTCGGACATGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-263s21c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1948s21c1
Sequence:CCGGGCGAGAGCAAAGGATACTATTCTCGAGAATAGTATCCTTTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-2234s21c1
Sequence:CCGGATGTATCCTTCACGTTGTAAACTCGAGTTTACAACGTGAAGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016628
VALIDATED
WAC MISSION shRNA shRNA Plasmid DNA
WW domain containing adaptor with coiled-coil
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-253s1c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-524s1c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-1448s1c1
Sequence:CCGGCTCAAACTAACACAGTCCCTACTCGAGTAGGGACTGTGTTAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1822s1c1
Sequence:CCGGGCATCAAGATTACGCGAAGAACTCGAGTTCTTCGCGTAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1368s1c1
Sequence:CCGGGCCATCTAATCAGTCTCCGATCTCGAGATCGGAGACTGATTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016628.2-2725s1c1
Sequence:CCGGGCAGTGATTGAGCATAACCTACTCGAGTAGGTTATGCTCAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-534s21c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1869s21c1
Sequence:CCGGCTATTCACATGTCCGAAATTTCTCGAGAAATTTCGGACATGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-263s21c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1948s21c1
Sequence:CCGGGCGAGAGCAAAGGATACTATTCTCGAGAATAGTATCCTTTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-2234s21c1
Sequence:CCGGATGTATCCTTCACGTTGTAAACTCGAGTTTACAACGTGAAGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016628
VALIDATED
WAC MISSION shRNA Lentiviral Transduction Particles
WW domain containing adaptor with coiled-coil
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-253s1c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-524s1c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016628.2-1448s1c1
Sequence:CCGGCTCAAACTAACACAGTCCCTACTCGAGTAGGGACTGTGTTAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1822s1c1
Sequence:CCGGGCATCAAGATTACGCGAAGAACTCGAGTTCTTCGCGTAATCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016628.2-1368s1c1
Sequence:CCGGGCCATCTAATCAGTCTCCGATCTCGAGATCGGAGACTGATTAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016628.2-2725s1c1
Sequence:CCGGGCAGTGATTGAGCATAACCTACTCGAGTAGGTTATGCTCAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-534s21c1
Sequence:CCGGGTCGAACAGAAGTTTCACAATCTCGAGATTGTGAAACTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1869s21c1
Sequence:CCGGCTATTCACATGTCCGAAATTTCTCGAGAAATTTCGGACATGTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-263s21c1
Sequence:CCGGCGGAGATCTGATAGTCCTGAACTCGAGTTCAGGACTATCAGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-1948s21c1
Sequence:CCGGGCGAGAGCAAAGGATACTATTCTCGAGAATAGTATCCTTTGCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016628.3-2234s21c1
Sequence:CCGGATGTATCCTTCACGTTGTAAACTCGAGTTTACAACGTGAAGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks