EMAIL THIS PAGE TO A FRIEND

WAPAL

wings apart-like homolog (Drosophila)

Synonyms: FOE KIAA0261 WAPL
UniProtKB ID: Q7Z5K2, A7E2B5, Q5VSK5, Q8IX10, Q92549
Gene ID:
Mouse(218914) wings apart-like homolog (Drosophila)
Rat(290577) wings apart-like homolog (Drosophila)
domestic guinea pig(100726455) wings apart-like homolog (Drosophila)
naked mole-rat(101702640) wings apart-like homolog (Drosophila)
cow(534322) wings apart-like homolog (Drosophila)
Goat(100861086) wings apart-like homolog (Drosophila)
sheep(101114585) wings apart-like homolog (Drosophila)
chicken(423608) wings apart-like homolog (Drosophila)
domestic cat(101084992) wings apart-like homolog (Drosophila)
Horse(100052524) wings apart-like homolog (Drosophila)
dog(612854) wings apart-like homolog (Drosophila)
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015045 Rosetta Predictions human pricing
XR_006087 Rosetta Predictions rat pricing
NM_001004436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132105 predicted 2781
2 SASI_Hs01_00132107 predicted 3417
3 SASI_Hs01_00132108 predicted 1502
4 SASI_Hs01_00132109 predicted 3075
5 SASI_Hs01_00132110 predicted 1174
6 SASI_Hs02_00346884 predicted 2333
7 SASI_Hs02_00346885 predicted 1491
8 SASI_Hs02_00346886 predicted 3936
9 SASI_Hs01_00132112 predicted 1414
10 SASI_Hs01_00132113 predicted 2306
11 SASI_Hs01_00132104 predicted 2934
12 SASI_Hs01_00132106 predicted 3307
13 SASI_Hs01_00132111 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179242 predicted 3310
2 SASI_Rn01_00179243 predicted 2907
3 SASI_Rn02_00410978 predicted 2546
4 SASI_Rn01_00179245 predicted 4317
5 SASI_Rn01_00179246 predicted 4015
6 SASI_Rn01_00179247 predicted 4393
7 SASI_Rn02_00410979 predicted 3119
8 SASI_Rn01_00179249 predicted 3146
9 SASI_Rn01_00179250 predicted 3804
10 SASI_Rn01_00179251 predicted 4886
11 SASI_Rn01_00179244 predicted 3546
12 SASI_Rn01_00179248 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112970 predicted 2447
2 SASI_Mm01_00112971 predicted 1597
3 SASI_Mm01_00112972 predicted 926
4 SASI_Mm01_00112973 predicted 3925
5 SASI_Mm02_00286548 predicted 3540
6 SASI_Mm01_00112974 predicted 809
7 SASI_Mm01_00112975 predicted 3221
8 SASI_Mm01_00112976 predicted 3060
9 SASI_Mm01_00112977 predicted 3893
10 SASI_Mm01_00112978 predicted 3281
11 SASI_Mm01_00112979 predicted 3630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004436
VALIDATED
WAPAL MISSION shRNA Bacterial Glycerol Stock
wings apart-like homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-2842s1c1
Sequence:CCGGGCAGAGAGATGTTTACGAGTTCTCGAGAACTCGTAAACATCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-856s1c1
Sequence:CCGGGCAGTGGCTTCTGAATATAAACTCGAGTTTATATTCAGAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-862s1c1
Sequence:CCGGGCTTCTGAATATAAAGCTGATCTCGAGATCAGCTTTATATTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-406s1c1
Sequence:CCGGCCCAATTTCAAACCAGATATTCTCGAGAATATCTGGTTTGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004436
VALIDATED
WAPAL MISSION shRNA shRNA Plasmid DNA
wings apart-like homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-2842s1c1
Sequence:CCGGGCAGAGAGATGTTTACGAGTTCTCGAGAACTCGTAAACATCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-856s1c1
Sequence:CCGGGCAGTGGCTTCTGAATATAAACTCGAGTTTATATTCAGAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-862s1c1
Sequence:CCGGGCTTCTGAATATAAAGCTGATCTCGAGATCAGCTTTATATTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-406s1c1
Sequence:CCGGCCCAATTTCAAACCAGATATTCTCGAGAATATCTGGTTTGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004436
VALIDATED
WAPAL MISSION shRNA Lentiviral Transduction Particles
wings apart-like homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-2842s1c1
Sequence:CCGGGCAGAGAGATGTTTACGAGTTCTCGAGAACTCGTAAACATCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004436.1-856s1c1
Sequence:CCGGGCAGTGGCTTCTGAATATAAACTCGAGTTTATATTCAGAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-862s1c1
Sequence:CCGGGCTTCTGAATATAAAGCTGATCTCGAGATCAGCTTTATATTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004436.1-406s1c1
Sequence:CCGGCCCAATTTCAAACCAGATATTCTCGAGAATATCTGGTTTGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015045
VALIDATED
WAPAL MISSION shRNA Bacterial Glycerol Stock
wings apart-like homolog (Drosophila)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5932s1c1
Sequence:CCGGGCACTGATAGAGATGCAGATTCTCGAGAATCTGCATCTCTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-1505s1c1
Sequence:CCGGCGGACTAGAGATTACACTGTTCTCGAGAACAGTGTAATCTCTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-3188s1c1
Sequence:CCGGCACCAGAATGTAACTAACCATCTCGAGATGGTTAGTTACATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-589s1c1
Sequence:CCGGGCCCAATTTCAAACCAGATATCTCGAGATATCTGGTTTGAAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-2024s1c1
Sequence:CCGGCCCATAAATAAACAAGGAGATCTCGAGATCTCCTTGTTTATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-715s1c1
Sequence:CCGGCCAGGTTAAGTGTTCCTCTTACTCGAGTAAGAGGAACACTTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167262    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5440s1c1
Sequence:CCGGCCTTCTATTGTCTTCCTATTTCTCGAGAAATAGGAAGACAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4162s21c1
Sequence:CCGGTTCGTCATGCATTCGGCATTTCTCGAGAAATGCCGAATGCATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1325s21c1
Sequence:CCGGACGTACTGTAGGGCCAATAAACTCGAGTTTATTGGCCCTACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3860s21c1
Sequence:CCGGGTAACCACTGTGCGGGAATATCTCGAGATATTCCCGCACAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1674s21c1
Sequence:CCGGCTAGATTTCGACCTAGTAATACTCGAGTATTACTAGGTCGAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4506s21c1
Sequence:CCGGGAATGATTCCAATCGTAAATACTCGAGTATTTACGATTGGAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3050s21c1
Sequence:CCGGAGCTACTTGATAGCATATAAACTCGAGTTTATATGCTATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015045
VALIDATED
WAPAL MISSION shRNA shRNA Plasmid DNA
wings apart-like homolog (Drosophila)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5932s1c1
Sequence:CCGGGCACTGATAGAGATGCAGATTCTCGAGAATCTGCATCTCTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-1505s1c1
Sequence:CCGGCGGACTAGAGATTACACTGTTCTCGAGAACAGTGTAATCTCTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-3188s1c1
Sequence:CCGGCACCAGAATGTAACTAACCATCTCGAGATGGTTAGTTACATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-589s1c1
Sequence:CCGGGCCCAATTTCAAACCAGATATCTCGAGATATCTGGTTTGAAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-2024s1c1
Sequence:CCGGCCCATAAATAAACAAGGAGATCTCGAGATCTCCTTGTTTATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-715s1c1
Sequence:CCGGCCAGGTTAAGTGTTCCTCTTACTCGAGTAAGAGGAACACTTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167262    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5440s1c1
Sequence:CCGGCCTTCTATTGTCTTCCTATTTCTCGAGAAATAGGAAGACAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4162s21c1
Sequence:CCGGTTCGTCATGCATTCGGCATTTCTCGAGAAATGCCGAATGCATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1325s21c1
Sequence:CCGGACGTACTGTAGGGCCAATAAACTCGAGTTTATTGGCCCTACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3860s21c1
Sequence:CCGGGTAACCACTGTGCGGGAATATCTCGAGATATTCCCGCACAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1674s21c1
Sequence:CCGGCTAGATTTCGACCTAGTAATACTCGAGTATTACTAGGTCGAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4506s21c1
Sequence:CCGGGAATGATTCCAATCGTAAATACTCGAGTATTTACGATTGGAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3050s21c1
Sequence:CCGGAGCTACTTGATAGCATATAAACTCGAGTTTATATGCTATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015045
VALIDATED
WAPAL MISSION shRNA Lentiviral Transduction Particles
wings apart-like homolog (Drosophila)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5932s1c1
Sequence:CCGGGCACTGATAGAGATGCAGATTCTCGAGAATCTGCATCTCTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-1505s1c1
Sequence:CCGGCGGACTAGAGATTACACTGTTCTCGAGAACAGTGTAATCTCTAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015045.1-3188s1c1
Sequence:CCGGCACCAGAATGTAACTAACCATCTCGAGATGGTTAGTTACATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-589s1c1
Sequence:CCGGGCCCAATTTCAAACCAGATATCTCGAGATATCTGGTTTGAAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-2024s1c1
Sequence:CCGGCCCATAAATAAACAAGGAGATCTCGAGATCTCCTTGTTTATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015045.1-715s1c1
Sequence:CCGGCCAGGTTAAGTGTTCCTCTTACTCGAGTAAGAGGAACACTTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167262    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015045.1-5440s1c1
Sequence:CCGGCCTTCTATTGTCTTCCTATTTCTCGAGAAATAGGAAGACAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4162s21c1
Sequence:CCGGTTCGTCATGCATTCGGCATTTCTCGAGAAATGCCGAATGCATGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1325s21c1
Sequence:CCGGACGTACTGTAGGGCCAATAAACTCGAGTTTATTGGCCCTACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3860s21c1
Sequence:CCGGGTAACCACTGTGCGGGAATATCTCGAGATATTCCCGCACAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-1674s21c1
Sequence:CCGGCTAGATTTCGACCTAGTAATACTCGAGTATTACTAGGTCGAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-4506s21c1
Sequence:CCGGGAATGATTCCAATCGTAAATACTCGAGTATTTACGATTGGAATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015045.2-3050s21c1
Sequence:CCGGAGCTACTTGATAGCATATAAACTCGAGTTTATATGCTATCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks