EMAIL THIS PAGE TO A FRIEND

WARS2

tryptophanyl tRNA synthetase 2, mitochondrial

Synonyms: TrpRS
UniProtKB ID: Q9UGM6, B1ALR1, B2R9D4, Q53FT4, Q5VUD2, Q86TQ0
Gene ID:
Human(10352) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(70560) tryptophanyl tRNA synthetase 2 (mitochondrial)
Rat(690654) tryptophanyl tRNA synthetase 2 (mitochondrial)
Zebrafish(503745) tryptophanyl tRNA synthetase 2, mitochondrial
chicken(418312) tryptophanyl tRNA synthetase 2, mitochondrial
domestic cat(101088014) tryptophanyl tRNA synthetase 2, mitochondrial
dog(483145) tryptophanyl tRNA synthetase 2, mitochondrial
domestic guinea pig(100714075) tryptophanyl tRNA synthetase 2, mitochondrial
naked mole-rat(101705184) tryptophanyl tRNA synthetase 2, mitochondrial
Domestic Rabbit(100349675) tryptophanyl tRNA synthetase 2, mitochondrial
cow(532903) tryptophanyl tRNA synthetase 2, mitochondrial
sheep(101110551) tryptophanyl tRNA synthetase 2, mitochondrial
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015836 Rosetta Predictions human pricing
NM_201263 Rosetta Predictions human pricing
XM_001075111 Rosetta Predictions rat pricing
NM_027462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224433 predicted 358
2 SASI_Hs01_00224434 predicted 1116
3 SASI_Hs01_00224436 predicted 1380
4 SASI_Hs02_00348424 predicted 228
5 SASI_Hs01_00224437 predicted 910
6 SASI_Hs01_00224438 predicted 1404
7 SASI_Hs01_00224439 predicted 1392
8 SASI_Hs02_00348425 predicted 200
9 SASI_Hs01_00224441 predicted 214
10 SASI_Hs01_00224442 predicted 413
11 SASI_Hs01_00224435 predicted 1196
12 SASI_Hs01_00224440 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042572 predicted 363
2 SASI_Hs02_00372907 predicted 203
3 SASI_Hs01_00042573 predicted 1148
4 SASI_Hs01_00042576 predicted 417
5 SASI_Hs01_00042577 predicted 935
6 SASI_Hs01_00042578 predicted 1094
7 SASI_Hs01_00042580 predicted 215
8 SASI_Hs01_00042581 predicted 1178
9 SASI_Hs02_00372908 predicted 1039
10 SASI_Hs02_00372909 predicted 1074
11 SASI_Hs01_00042574 predicted 297
12 SASI_Hs01_00042575 predicted 222
13 SASI_Hs01_00042579 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348497 predicted 935
2 SASI_Rn02_00348498 predicted 992
3 SASI_Rn02_00348499 predicted 1410
4 SASI_Rn02_00348500 predicted 1483
5 SASI_Rn02_00348501 predicted 1387
6 SASI_Rn02_00348502 predicted 1223
7 SASI_Rn02_00348503 predicted 1362
8 SASI_Rn02_00348504 predicted 1443
9 SASI_Rn02_00348505 predicted 1431
10 SASI_Rn02_00348506 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022180 predicted 1168
2 SASI_Mm01_00022181 predicted 1180
3 SASI_Mm02_00332254 predicted 300
4 SASI_Mm01_00022182 predicted 694
5 SASI_Mm01_00022183 predicted 503
6 SASI_Mm01_00022184 predicted 604
7 SASI_Mm02_00332255 predicted 1050
8 SASI_Mm01_00022185 predicted 1036
9 SASI_Mm01_00022186 predicted 365
10 SASI_Mm01_00022187 predicted 1030
11 SASI_Mm01_00022188 predicted 648
12 SASI_Mm01_00022189 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015836
VALIDATED
WARS2 MISSION shRNA Bacterial Glycerol Stock
tryptophanyl tRNA synthetase 2, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-420s1c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015836.2-751s1c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-641s1c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-198s1c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-114s1c1
Sequence:CCGGGACAGCAAGAAGCGAGTATTTCTCGAGAAATACTCGCTTCTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-759s21c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-649s21c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-428s21c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-206s21c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015836
VALIDATED
WARS2 MISSION shRNA shRNA Plasmid DNA
tryptophanyl tRNA synthetase 2, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-420s1c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015836.2-751s1c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-641s1c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-198s1c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-114s1c1
Sequence:CCGGGACAGCAAGAAGCGAGTATTTCTCGAGAAATACTCGCTTCTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-759s21c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-649s21c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-428s21c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-206s21c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015836
VALIDATED
WARS2 MISSION shRNA Lentiviral Transduction Particles
tryptophanyl tRNA synthetase 2, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-420s1c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015836.2-751s1c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-641s1c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-198s1c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015836.2-114s1c1
Sequence:CCGGGACAGCAAGAAGCGAGTATTTCTCGAGAAATACTCGCTTCTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-759s21c1
Sequence:CCGGCAGAGGAGATAGTGCAGAAATCTCGAGATTTCTGCACTATCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-649s21c1
Sequence:CCGGCGAGTCCATTCTCACATCCATCTCGAGATGGATGTGAGAATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-428s21c1
Sequence:CCGGCCTCGATTACAACATTTACATCTCGAGATGTAAATGTTGTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015836.3-206s21c1
Sequence:CCGGGTGAGGTTACAGGATGAATATCTCGAGATATTCATCCTGTAACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027462
WARS2 MISSION shRNA Bacterial Glycerol Stock
tryptophanyl tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-929s1c1
Sequence:CCGGGCCGATGCTGTGATTGAGAAACTCGAGTTTCTCAATCACAGCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027462.2-2330s1c1
Sequence:CCGGGCTCTGTGAAATCACAGAGTACTCGAGTACTCTGTGATTTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-347s1c1
Sequence:CCGGCAGCAGTCTAAGGTGTCTGAACTCGAGTTCAGACACCTTAGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-418s1c1
Sequence:CCGGGCAGCATTTACACCAGTGGAACTCGAGTTCCACTGGTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-200s1c1
Sequence:CCGGGAGGAATATGACACAGTGATACTCGAGTATCACTGTGTCATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-711s21c1
Sequence:CCGGACTCGCCACTGTTCGAATAACCTCGAGGTTATTCGAACAGTGGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-577s21c1
Sequence:CCGGCAGGATCTAGCTCGAAGTTTCCTCGAGGAAACTTCGAGCTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027462.4-1418s21c1
Sequence:CCGGTTCATAAAGAGAGGTTCATTCCTCGAGGAATGAACCTCTCTTTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027462
WARS2 MISSION shRNA shRNA Plasmid DNA
tryptophanyl tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-929s1c1
Sequence:CCGGGCCGATGCTGTGATTGAGAAACTCGAGTTTCTCAATCACAGCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027462.2-2330s1c1
Sequence:CCGGGCTCTGTGAAATCACAGAGTACTCGAGTACTCTGTGATTTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-347s1c1
Sequence:CCGGCAGCAGTCTAAGGTGTCTGAACTCGAGTTCAGACACCTTAGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-418s1c1
Sequence:CCGGGCAGCATTTACACCAGTGGAACTCGAGTTCCACTGGTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-200s1c1
Sequence:CCGGGAGGAATATGACACAGTGATACTCGAGTATCACTGTGTCATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-711s21c1
Sequence:CCGGACTCGCCACTGTTCGAATAACCTCGAGGTTATTCGAACAGTGGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-577s21c1
Sequence:CCGGCAGGATCTAGCTCGAAGTTTCCTCGAGGAAACTTCGAGCTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027462.4-1418s21c1
Sequence:CCGGTTCATAAAGAGAGGTTCATTCCTCGAGGAATGAACCTCTCTTTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027462
WARS2 MISSION shRNA Lentiviral Transduction Particles
tryptophanyl tRNA synthetase 2, mitochondrial
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-929s1c1
Sequence:CCGGGCCGATGCTGTGATTGAGAAACTCGAGTTTCTCAATCACAGCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027462.2-2330s1c1
Sequence:CCGGGCTCTGTGAAATCACAGAGTACTCGAGTACTCTGTGATTTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-347s1c1
Sequence:CCGGCAGCAGTCTAAGGTGTCTGAACTCGAGTTCAGACACCTTAGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-418s1c1
Sequence:CCGGGCAGCATTTACACCAGTGGAACTCGAGTTCCACTGGTGTAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027462.2-200s1c1
Sequence:CCGGGAGGAATATGACACAGTGATACTCGAGTATCACTGTGTCATATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-711s21c1
Sequence:CCGGACTCGCCACTGTTCGAATAACCTCGAGGTTATTCGAACAGTGGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027462.4-577s21c1
Sequence:CCGGCAGGATCTAGCTCGAAGTTTCCTCGAGGAAACTTCGAGCTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027462.4-1418s21c1
Sequence:CCGGTTCATAAAGAGAGGTTCATTCCTCGAGGAATGAACCTCTCTTTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks