EMAIL THIS PAGE TO A FRIEND

WARS

tryptophanyl-tRNA synthetase

Synonyms: GAMMA-2 IFI53 IFP53
Gene ID:
Human(7453) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22375) tryptophanyl-tRNA synthetase
Rat(314442) tryptophanyl-tRNA synthetase
cow(281576) tryptophanyl-tRNA synthetase
sheep(101123073) tryptophanyl-tRNA synthetase
naked mole-rat(101703651) tryptophanyl-tRNA synthetase
domestic guinea pig(100732067) tryptophanyl-tRNA synthetase
Zebrafish(393745) tryptophanyl-tRNA synthetase
chicken(423458) tryptophanyl-tRNA synthetase
domestic cat(101093944) tryptophanyl-tRNA synthetase
Horse(100054884) tryptophanyl-tRNA synthetase
dog(480435) tryptophanyl-tRNA synthetase
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004184 Rosetta Predictions human pricing
NM_173701 Rosetta Predictions human pricing
NM_213645 Rosetta Predictions human pricing
NM_213646 Rosetta Predictions human pricing
NM_001013170 Rosetta Predictions rat pricing
XM_343110 Rosetta Predictions rat pricing
NM_011710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104061 predicted 887
2 SASI_Hs01_00104062 predicted 1785
3 SASI_Hs01_00104063 predicted 1822
4 SASI_Hs01_00104064 predicted 713
5 SASI_Hs02_00337067 predicted 865
6 SASI_Hs01_00104065 predicted 1300
7 SASI_Hs01_00104067 predicted 799
8 SASI_Hs01_00104068 predicted 1487
9 SASI_Hs01_00104069 predicted 1140
10 SASI_Hs01_00104070 predicted 718
11 SASI_Hs01_00104066 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041377 predicted 663
2 SASI_Hs01_00041378 predicted 1557
3 SASI_Hs01_00041379 predicted 1598
4 SASI_Hs01_00041380 predicted 495
5 SASI_Hs02_00368642 predicted 643
6 SASI_Hs01_00041381 predicted 1078
7 SASI_Hs01_00041383 predicted 572
8 SASI_Hs01_00041384 predicted 1265
9 SASI_Hs01_00041385 predicted 924
10 SASI_Hs01_00041386 predicted 498
11 SASI_Hs01_00041382 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160675 predicted 482
2 SASI_Hs01_00160676 predicted 1385
3 SASI_Hs01_00160677 predicted 1429
4 SASI_Hs01_00160678 predicted 314
5 SASI_Hs02_00374322 predicted 468
6 SASI_Hs01_00160679 predicted 908
7 SASI_Hs01_00160681 predicted 401
8 SASI_Hs01_00160682 predicted 1091
9 SASI_Hs01_00160683 predicted 749
10 SASI_Hs01_00160684 predicted 330
11 SASI_Hs01_00160680 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082498 predicted 707
2 SASI_Hs01_00082499 predicted 1606
3 SASI_Hs01_00082500 predicted 1656
4 SASI_Hs01_00082501 predicted 541
5 SASI_Hs02_00374323 predicted 698
6 SASI_Hs01_00082502 predicted 1134
7 SASI_Hs01_00082504 predicted 628
8 SASI_Hs01_00082505 predicted 1319
9 SASI_Hs01_00082506 predicted 969
10 SASI_Hs01_00082507 predicted 545
11 SASI_Hs01_00082503 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086385 predicted 240
2 SASI_Rn01_00086386 predicted 1051
3 SASI_Rn01_00086387 predicted 1225
4 SASI_Rn02_00200923 predicted 821
5 SASI_Rn01_00086388 predicted 1566
6 SASI_Rn01_00086389 predicted 922
7 SASI_Rn01_00086390 predicted 432
8 SASI_Rn01_00086391 predicted 1337
9 SASI_Rn01_00086392 predicted 663
10 SASI_Rn01_00086393 predicted 1641
11 SASI_Rn01_00086394 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146512 predicted 546
2 SASI_Rn01_00146513 predicted 944
3 SASI_Rn01_00146514 predicted 641
4 SASI_Rn01_00146515 predicted 822
5 SASI_Rn01_00146516 predicted 1007
6 SASI_Rn01_00146517 predicted 895
7 SASI_Rn01_00146518 predicted 677
8 SASI_Rn01_00146519 predicted 938
9 SASI_Rn01_00146520 predicted 903
10 SASI_Rn01_00146521 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094833 predicted 739
2 SASI_Mm01_00094834 predicted 1037
3 SASI_Mm01_00094835 predicted 320
4 SASI_Mm01_00094836 predicted 1208
5 SASI_Mm01_00094837 predicted 214
6 SASI_Mm01_00094838 predicted 218
7 SASI_Mm01_00094839 predicted 447
8 SASI_Mm01_00094840 predicted 622
9 SASI_Mm01_00094841 predicted 1294
10 SASI_Mm02_00321278 predicted 839
11 SASI_Mm01_00094842 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004184
WARS MISSION shRNA Bacterial Glycerol Stock
tryptophanyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1059s21c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-580s21c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-720s21c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1776s21c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1735s21c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-386s1c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1582s1c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-526s1c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1541s1c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-865s1c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004184
WARS MISSION shRNA shRNA Plasmid DNA
tryptophanyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1059s21c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-580s21c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-720s21c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1776s21c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1735s21c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-386s1c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1582s1c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-526s1c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1541s1c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-865s1c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004184
WARS MISSION shRNA Lentiviral Transduction Particles
tryptophanyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1059s21c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-580s21c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-720s21c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1776s21c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004184.3-1735s21c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-386s1c1
Sequence:CCGGCCAGCACCTACCAGTAATCATCTCGAGATGATTACTGGTAGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1582s1c1
Sequence:CCGGGCTGTCCTTCGACTTTCAGTACTCGAGTACTGAAAGTCGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-526s1c1
Sequence:CCGGCAAAGAGCTAATAAACCGAATCTCGAGATTCGGTTTATTAGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-1541s1c1
Sequence:CCGGGTCACGGATGAGATAGTGAAACTCGAGTTTCACTATCTCATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004184.2-865s1c1
Sequence:CCGGCTTTGACATCAACAAGACTTTCTCGAGAAAGTCTTGTTGATGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011710
VALIDATED
WARS MISSION shRNA Bacterial Glycerol Stock
tryptophanyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1676s1c1
Sequence:CCGGCTCCACTCAGAGTCTTGGAAACTCGAGTTTCCAAGACTCTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011710.2-529s1c1
Sequence:CCGGCCACCGAGATATGAATCAAATCTCGAGATTTGATTCATATCTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-530s1c1
Sequence:CCGGCACCGAGATATGAATCAAATTCTCGAGAATTTGATTCATATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1000s1c1
Sequence:CCGGCTTCCGAGACAGGACAGATATCTCGAGATATCTGTCCTGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-743s1c1
Sequence:CCGGGCATATAGCTACACCGTAGAACTCGAGTTCTACGGTGTAGCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011710
VALIDATED
WARS MISSION shRNA shRNA Plasmid DNA
tryptophanyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1676s1c1
Sequence:CCGGCTCCACTCAGAGTCTTGGAAACTCGAGTTTCCAAGACTCTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011710.2-529s1c1
Sequence:CCGGCCACCGAGATATGAATCAAATCTCGAGATTTGATTCATATCTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-530s1c1
Sequence:CCGGCACCGAGATATGAATCAAATTCTCGAGAATTTGATTCATATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1000s1c1
Sequence:CCGGCTTCCGAGACAGGACAGATATCTCGAGATATCTGTCCTGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-743s1c1
Sequence:CCGGGCATATAGCTACACCGTAGAACTCGAGTTCTACGGTGTAGCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011710
VALIDATED
WARS MISSION shRNA Lentiviral Transduction Particles
tryptophanyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1676s1c1
Sequence:CCGGCTCCACTCAGAGTCTTGGAAACTCGAGTTTCCAAGACTCTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011710.2-529s1c1
Sequence:CCGGCCACCGAGATATGAATCAAATCTCGAGATTTGATTCATATCTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-530s1c1
Sequence:CCGGCACCGAGATATGAATCAAATTCTCGAGAATTTGATTCATATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-1000s1c1
Sequence:CCGGCTTCCGAGACAGGACAGATATCTCGAGATATCTGTCCTGTCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011710.2-743s1c1
Sequence:CCGGGCATATAGCTACACCGTAGAACTCGAGTTCTACGGTGTAGCTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks