EMAIL THIS PAGE TO A FRIEND

WAS

Wiskott-Aldrich syndrome

Synonyms: IMD2 SCNX THC THC1 WASP
UniProtKB ID: P42768, Q9BU11, Q9UNJ9
Gene ID:
Human(7454) Summary: The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(22376) Wiskott-Aldrich syndrome homolog (human)
Rat(317371) Wiskott-Aldrich syndrome
dog(491867) Wiskott-Aldrich syndrome
domestic cat(101095721) Wiskott-Aldrich syndrome
cow(100336547) Wiskott-Aldrich syndrome
sheep(101114336) Wiskott-Aldrich syndrome
naked mole-rat(101704700) Wiskott-Aldrich syndrome
domestic guinea pig(100730969) Wiskott-Aldrich syndrome
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000377 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000377 Rosetta Predictions human pricing
NM_001108248 Rosetta Predictions rat pricing
NM_009515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099176 predicted 264
2 SASI_Hs01_00099177 predicted 669
3 SASI_Hs01_00099178 predicted 702
4 SASI_Hs02_00302436 predicted 265
5 SASI_Hs01_00099179 predicted 708
6 SASI_Hs01_00099180 predicted 848
7 SASI_Hs01_00099181 predicted 845
8 SASI_Hs01_00099182 predicted 294
9 SASI_Hs01_00099183 predicted 812
10 SASI_Hs01_00099184 predicted 853
11 SASI_Hs01_00099185 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236784 predicted 796
2 SASI_Rn02_00236785 predicted 886
3 SASI_Rn02_00236786 predicted 719
4 SASI_Rn02_00236787 predicted 597
5 SASI_Rn02_00236788 predicted 1116
6 SASI_Rn02_00236789 predicted 461
7 SASI_Rn02_00236790 predicted 325
8 SASI_Rn02_00236791 predicted 696
9 SASI_Rn02_00236792 predicted 257
10 SASI_Rn02_00236793 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159681 predicted 645
2 SASI_Mm01_00159682 predicted 396
3 SASI_Mm01_00159683 predicted 1776
4 SASI_Mm01_00159684 predicted 615
5 SASI_Mm01_00159685 predicted 466
6 SASI_Mm01_00159686 predicted 271
7 SASI_Mm01_00159687 predicted 1779
8 SASI_Mm01_00159688 predicted 1714
9 SASI_Mm01_00159689 predicted 696
10 SASI_Mm01_00159690 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000377
VALIDATED
WAS MISSION shRNA Bacterial Glycerol Stock
Wiskott-Aldrich syndrome
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-673s21c1
Sequence:GTACCGGGACATCACGAGTTCACGATACCTCGAGGTATCGTGAACTCGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-104s21c1
Sequence:CCGGCAGCGGTTCAGCAGAACATACCTCGAGGTATGTTCTGCTGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-146s21c1
Sequence:CCGGACGAGAACCAGCGACTCTTTGCTCGAGCAAAGAGTCGCTGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-906s21c1
Sequence:CCGGCGCCGAGACCTCTAAACTTATCTCGAGATAAGTTTAGAGGTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-301s21c1
Sequence:CCGGTCCTACTTCATCCGCCTTTACCTCGAGGTAAAGGCGGATGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-886s1c1
Sequence:CCGGCGAGACCTCTAAACTTATCTACTCGAGTAGATAAGTTTAGAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-796s1c1
Sequence:CCGGCCAGAATGGATTTGACGTGAACTCGAGTTCACGTCAAATCCATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-334s1c1
Sequence:CCGGGCTGTACTCACAGCTTGTCTACTCGAGTAGACAAGCTGTGAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-277s1c1
Sequence:CCGGGTCCTACTTCATCCGCCTTTACTCGAGTAAAGGCGGATGAAGTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-1351s1c1
Sequence:CCGGGCAGGGAATTCAGCTGAACAACTCGAGTTGTTCAGCTGAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000377
VALIDATED
WAS MISSION shRNA shRNA Plasmid DNA
Wiskott-Aldrich syndrome
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-673s21c1
Sequence:GTACCGGGACATCACGAGTTCACGATACCTCGAGGTATCGTGAACTCGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-104s21c1
Sequence:CCGGCAGCGGTTCAGCAGAACATACCTCGAGGTATGTTCTGCTGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-146s21c1
Sequence:CCGGACGAGAACCAGCGACTCTTTGCTCGAGCAAAGAGTCGCTGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-906s21c1
Sequence:CCGGCGCCGAGACCTCTAAACTTATCTCGAGATAAGTTTAGAGGTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-301s21c1
Sequence:CCGGTCCTACTTCATCCGCCTTTACCTCGAGGTAAAGGCGGATGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-886s1c1
Sequence:CCGGCGAGACCTCTAAACTTATCTACTCGAGTAGATAAGTTTAGAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-796s1c1
Sequence:CCGGCCAGAATGGATTTGACGTGAACTCGAGTTCACGTCAAATCCATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-334s1c1
Sequence:CCGGGCTGTACTCACAGCTTGTCTACTCGAGTAGACAAGCTGTGAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-277s1c1
Sequence:CCGGGTCCTACTTCATCCGCCTTTACTCGAGTAAAGGCGGATGAAGTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-1351s1c1
Sequence:CCGGGCAGGGAATTCAGCTGAACAACTCGAGTTGTTCAGCTGAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000377
VALIDATED
WAS MISSION shRNA Lentiviral Transduction Particles
Wiskott-Aldrich syndrome
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-673s21c1
Sequence:GTACCGGGACATCACGAGTTCACGATACCTCGAGGTATCGTGAACTCGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-104s21c1
Sequence:CCGGCAGCGGTTCAGCAGAACATACCTCGAGGTATGTTCTGCTGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-146s21c1
Sequence:CCGGACGAGAACCAGCGACTCTTTGCTCGAGCAAAGAGTCGCTGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-906s21c1
Sequence:CCGGCGCCGAGACCTCTAAACTTATCTCGAGATAAGTTTAGAGGTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000377.2-301s21c1
Sequence:CCGGTCCTACTTCATCCGCCTTTACCTCGAGGTAAAGGCGGATGAAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-886s1c1
Sequence:CCGGCGAGACCTCTAAACTTATCTACTCGAGTAGATAAGTTTAGAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-796s1c1
Sequence:CCGGCCAGAATGGATTTGACGTGAACTCGAGTTCACGTCAAATCCATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000377.1-334s1c1
Sequence:CCGGGCTGTACTCACAGCTTGTCTACTCGAGTAGACAAGCTGTGAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-277s1c1
Sequence:CCGGGTCCTACTTCATCCGCCTTTACTCGAGTAAAGGCGGATGAAGTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000377.1-1351s1c1
Sequence:CCGGGCAGGGAATTCAGCTGAACAACTCGAGTTGTTCAGCTGAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009515
WAS MISSION shRNA Bacterial Glycerol Stock
Wiskott-Aldrich syndrome
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-1568s21c1
Sequence:GTACCGGATGATGAATGGGATGACTAAACTCGAGTTTAGTCATCCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-617s21c1
Sequence:GTACCGGGACTTGTGACGGTCGACATTCCTCGAGGAATGTCGACCGTCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-477s21c1
Sequence:GTACCGGTCAGAGGCAAAGCGGAGAAAGCTCGAGCTTTCTCCGCTTTGCCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009515.1-1711s1c1
Sequence:CCGGCGTCACCTTTCACCTCTCATACTCGAGTATGAGAGGTGAAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-520s1c1
Sequence:CCGGGCACCAATCAATGAGGAGAGACTCGAGTCTCTCCTCATTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-792s1c1
Sequence:CCGGCCAGAATGGATTTGATGTGAACTCGAGTTCACATCAAATCCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-400s1c1
Sequence:CCGGGTAGGACTGAACTTTGCGGATCTCGAGATCCGCAAAGTTCAGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-1505s1c1
Sequence:CCGGAGAGGAGTAGAGTCATCCATTCTCGAGAATGGATGACTCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009515
WAS MISSION shRNA shRNA Plasmid DNA
Wiskott-Aldrich syndrome
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-1568s21c1
Sequence:GTACCGGATGATGAATGGGATGACTAAACTCGAGTTTAGTCATCCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-617s21c1
Sequence:GTACCGGGACTTGTGACGGTCGACATTCCTCGAGGAATGTCGACCGTCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-477s21c1
Sequence:GTACCGGTCAGAGGCAAAGCGGAGAAAGCTCGAGCTTTCTCCGCTTTGCCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009515.1-1711s1c1
Sequence:CCGGCGTCACCTTTCACCTCTCATACTCGAGTATGAGAGGTGAAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-520s1c1
Sequence:CCGGGCACCAATCAATGAGGAGAGACTCGAGTCTCTCCTCATTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-792s1c1
Sequence:CCGGCCAGAATGGATTTGATGTGAACTCGAGTTCACATCAAATCCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-400s1c1
Sequence:CCGGGTAGGACTGAACTTTGCGGATCTCGAGATCCGCAAAGTTCAGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-1505s1c1
Sequence:CCGGAGAGGAGTAGAGTCATCCATTCTCGAGAATGGATGACTCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009515
WAS MISSION shRNA Lentiviral Transduction Particles
Wiskott-Aldrich syndrome
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-1568s21c1
Sequence:GTACCGGATGATGAATGGGATGACTAAACTCGAGTTTAGTCATCCCATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-617s21c1
Sequence:GTACCGGGACTTGTGACGGTCGACATTCCTCGAGGAATGTCGACCGTCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009515.1-477s21c1
Sequence:GTACCGGTCAGAGGCAAAGCGGAGAAAGCTCGAGCTTTCTCCGCTTTGCCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009515.1-1711s1c1
Sequence:CCGGCGTCACCTTTCACCTCTCATACTCGAGTATGAGAGGTGAAAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-520s1c1
Sequence:CCGGGCACCAATCAATGAGGAGAGACTCGAGTCTCTCCTCATTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-792s1c1
Sequence:CCGGCCAGAATGGATTTGATGTGAACTCGAGTTCACATCAAATCCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-400s1c1
Sequence:CCGGGTAGGACTGAACTTTGCGGATCTCGAGATCCGCAAAGTTCAGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009515.1-1505s1c1
Sequence:CCGGAGAGGAGTAGAGTCATCCATTCTCGAGAATGGATGACTCTACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks