EMAIL THIS PAGE TO A FRIEND

WASF1

WAS protein family, member 1

Synonyms: SCAR1 WAVE WAVE1
UniProtKB ID: Q92558, E1P5F2, Q5SZK7
Gene ID:
Human(8936) Summary: The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(83767) WAS protein family, member 1
Rat(294568) WAS protein family, member 1
chicken(421761) WAS protein family, member 1
Horse(100066751) WAS protein family, member 1
domestic cat(101083083) WAS protein family, member 1
dog(475024) WAS protein family, member 1
domestic guinea pig(100716147) WAS protein family, member 1
naked mole-rat(101705685) WAS protein family, member 1
cow(531488) WAS protein family, member 1
sheep(101112488) WAS protein family, member 1
Gene Class: Cytoskeleton
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024934 Rosetta Predictions human pricing
NM_001024935 Rosetta Predictions human pricing
NM_001024936 Rosetta Predictions human pricing
NM_003931 Rosetta Predictions human pricing
NM_001025114 Rosetta Predictions rat pricing
NM_031877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046108 predicted 2194
2 SASI_Hs01_00046109 predicted 2350
3 SASI_Hs01_00046110 predicted 1472
4 SASI_Hs01_00046111 predicted 2069
5 SASI_Hs01_00046112 predicted 1194
6 SASI_Hs01_00046113 predicted 2300
7 SASI_Hs01_00046114 predicted 1616
8 SASI_Hs01_00046115 predicted 1026
9 SASI_Hs01_00046116 predicted 1387
10 SASI_Hs02_00307268 predicted 1479
11 SASI_Hs01_00046117 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098677 predicted 2150
2 SASI_Hs01_00098678 predicted 2294
3 SASI_Hs01_00098679 predicted 1428
4 SASI_Hs01_00098680 predicted 2020
5 SASI_Hs01_00098681 predicted 1145
6 SASI_Hs01_00098682 predicted 2247
7 SASI_Hs01_00098683 predicted 1571
8 SASI_Hs01_00098684 predicted 977
9 SASI_Hs01_00098685 predicted 1344
10 SASI_Hs02_00307269 predicted 1435
11 SASI_Hs01_00098686 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243695 predicted 2052
2 SASI_Hs01_00243696 predicted 2204
3 SASI_Hs01_00243697 predicted 1329
4 SASI_Hs01_00243698 predicted 1923
5 SASI_Hs01_00243699 predicted 1047
6 SASI_Hs01_00243700 predicted 2156
7 SASI_Hs01_00243701 predicted 1478
8 SASI_Hs01_00243702 predicted 885
9 SASI_Hs01_00243703 predicted 1238
10 SASI_Hs02_00307270 predicted 1335
11 SASI_Hs01_00243704 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230492 predicted 2290
2 SASI_Hs01_00230493 predicted 2445
3 SASI_Hs01_00230494 predicted 1568
4 SASI_Hs01_00230495 predicted 2158
5 SASI_Hs01_00230496 predicted 1295
6 SASI_Hs01_00230497 predicted 2392
7 SASI_Hs01_00230498 predicted 1716
8 SASI_Hs01_00230499 predicted 1129
9 SASI_Hs01_00230500 predicted 1483
10 SASI_Hs02_00336580 predicted 1578
11 SASI_Hs01_00230501 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085367 predicted 1633
2 SASI_Rn01_00085368 predicted 328
3 SASI_Rn01_00085369 predicted 205
4 SASI_Rn01_00085370 predicted 832
5 SASI_Rn01_00085371 predicted 334
6 SASI_Rn01_00085372 predicted 839
7 SASI_Rn01_00085373 predicted 1286
8 SASI_Rn01_00085374 predicted 1588
9 SASI_Rn01_00085375 predicted 561
10 SASI_Rn01_00085376 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175295 predicted 829
2 SASI_Mm01_00175296 predicted 492
3 SASI_Mm01_00175297 predicted 432
4 SASI_Mm01_00175298 predicted 1782
5 SASI_Mm01_00175299 predicted 332
6 SASI_Mm01_00175300 predicted 944
7 SASI_Mm01_00175301 predicted 648
8 SASI_Mm01_00175302 predicted 1533
9 SASI_Mm01_00175303 predicted 288
10 SASI_Mm01_00175304 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031877
VALIDATED
WASF1 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031877.2-2062s1c1
Sequence:CCGGCCGTTATTAGAGTAGCAGATTCTCGAGAATCTGCTACTCTAATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-341s1c1
Sequence:CCGGGCAAGATATAACGATGAGAAACTCGAGTTTCTCATCGTTATATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-780s1c1
Sequence:CCGGCCACAGACATACGTGGATCATCTCGAGATGATCCACGTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-1072s1c1
Sequence:CCGGCCACTTCTTCACTAAGAGCTTCTCGAGAAGCTCTTAGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-137s1c1
Sequence:CCGGCGAACTGGAATGTGTAACCAACTCGAGTTGGTTACACATTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-782s21c1
Sequence:GTACCGGACAGACATACGTGGATCATATCTCGAGATATGATCCACGTATGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-2225s21c1
Sequence:CCGGGAAACACTGCCTCGATTATATCTCGAGATATAATCGAGGCAGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-721s21c1
Sequence:CCGGACCTCCTACACAAGCATATTGCTCGAGCAATATGCTTGTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-187s21c1
Sequence:CCGGTGAGTAGCCTAAGTAAGTATGCTCGAGCATACTTACTTAGGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031877
VALIDATED
WASF1 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031877.2-2062s1c1
Sequence:CCGGCCGTTATTAGAGTAGCAGATTCTCGAGAATCTGCTACTCTAATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-341s1c1
Sequence:CCGGGCAAGATATAACGATGAGAAACTCGAGTTTCTCATCGTTATATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-780s1c1
Sequence:CCGGCCACAGACATACGTGGATCATCTCGAGATGATCCACGTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-1072s1c1
Sequence:CCGGCCACTTCTTCACTAAGAGCTTCTCGAGAAGCTCTTAGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-137s1c1
Sequence:CCGGCGAACTGGAATGTGTAACCAACTCGAGTTGGTTACACATTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-782s21c1
Sequence:GTACCGGACAGACATACGTGGATCATATCTCGAGATATGATCCACGTATGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-2225s21c1
Sequence:CCGGGAAACACTGCCTCGATTATATCTCGAGATATAATCGAGGCAGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-721s21c1
Sequence:CCGGACCTCCTACACAAGCATATTGCTCGAGCAATATGCTTGTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-187s21c1
Sequence:CCGGTGAGTAGCCTAAGTAAGTATGCTCGAGCATACTTACTTAGGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031877
VALIDATED
WASF1 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031877.2-2062s1c1
Sequence:CCGGCCGTTATTAGAGTAGCAGATTCTCGAGAATCTGCTACTCTAATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-341s1c1
Sequence:CCGGGCAAGATATAACGATGAGAAACTCGAGTTTCTCATCGTTATATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-780s1c1
Sequence:CCGGCCACAGACATACGTGGATCATCTCGAGATGATCCACGTATGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-1072s1c1
Sequence:CCGGCCACTTCTTCACTAAGAGCTTCTCGAGAAGCTCTTAGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031877.2-137s1c1
Sequence:CCGGCGAACTGGAATGTGTAACCAACTCGAGTTGGTTACACATTCCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-782s21c1
Sequence:GTACCGGACAGACATACGTGGATCATATCTCGAGATATGATCCACGTATGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-2225s21c1
Sequence:CCGGGAAACACTGCCTCGATTATATCTCGAGATATAATCGAGGCAGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-721s21c1
Sequence:CCGGACCTCCTACACAAGCATATTGCTCGAGCAATATGCTTGTGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031877.2-187s21c1
Sequence:CCGGTGAGTAGCCTAAGTAAGTATGCTCGAGCATACTTACTTAGGCTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003931
VALIDATED
WASF1 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003931.2-3073s1c1
Sequence:CCGGCCCACTTATATATTGTGTGATCTCGAGATCACACAATATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2446s1c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003931.2-1473s1c1
Sequence:CCGGGCTGGCTGAAGATGATGCTAACTCGAGTTAGCATCATCTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2401s1c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-1297s1c1
Sequence:CCGGCCTTCGTATTTCTTTGATCTACTCGAGTAGATCAAAGAAATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1521s21c1
Sequence:GTACCGGTAATGGCCCAGCCTCTCATTTCTCGAGAAATGAGAGGCTGGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2446s21c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1047s21c1
Sequence:CCGGAGAACGTGTGGACCGTTTATCCTCGAGGATAAACGGTCCACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2401s21c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003931.2-2841s21c1
Sequence:CCGGTAAAGAAAGCAACTGAAATTGCTCGAGCAATTTCAGTTGCTTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-914s21c1
Sequence:GTACCGGTGGAATGTGTAACCAATATTTCTCGAGAAATATTGGTTACACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1102s21c1
Sequence:GTACCGGGAATTGTCTTTGCAAGATATACTCGAGTATATCTTGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003931
VALIDATED
WASF1 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003931.2-3073s1c1
Sequence:CCGGCCCACTTATATATTGTGTGATCTCGAGATCACACAATATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2446s1c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003931.2-1473s1c1
Sequence:CCGGGCTGGCTGAAGATGATGCTAACTCGAGTTAGCATCATCTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2401s1c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-1297s1c1
Sequence:CCGGCCTTCGTATTTCTTTGATCTACTCGAGTAGATCAAAGAAATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1521s21c1
Sequence:GTACCGGTAATGGCCCAGCCTCTCATTTCTCGAGAAATGAGAGGCTGGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2446s21c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1047s21c1
Sequence:CCGGAGAACGTGTGGACCGTTTATCCTCGAGGATAAACGGTCCACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2401s21c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003931.2-2841s21c1
Sequence:CCGGTAAAGAAAGCAACTGAAATTGCTCGAGCAATTTCAGTTGCTTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-914s21c1
Sequence:GTACCGGTGGAATGTGTAACCAATATTTCTCGAGAAATATTGGTTACACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1102s21c1
Sequence:GTACCGGGAATTGTCTTTGCAAGATATACTCGAGTATATCTTGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003931
VALIDATED
WASF1 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003931.2-3073s1c1
Sequence:CCGGCCCACTTATATATTGTGTGATCTCGAGATCACACAATATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2446s1c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003931.2-1473s1c1
Sequence:CCGGGCTGGCTGAAGATGATGCTAACTCGAGTTAGCATCATCTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-2401s1c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003931.2-1297s1c1
Sequence:CCGGCCTTCGTATTTCTTTGATCTACTCGAGTAGATCAAAGAAATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1521s21c1
Sequence:GTACCGGTAATGGCCCAGCCTCTCATTTCTCGAGAAATGAGAGGCTGGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2446s21c1
Sequence:CCGGCGCCGTATTGCTGTTGAATATCTCGAGATATTCAACAGCAATACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1047s21c1
Sequence:CCGGAGAACGTGTGGACCGTTTATCCTCGAGGATAAACGGTCCACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-2401s21c1
Sequence:CCGGGCTAAGCATGAACGCATTGAACTCGAGTTCAATGCGTTCATGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003931.2-2841s21c1
Sequence:CCGGTAAAGAAAGCAACTGAAATTGCTCGAGCAATTTCAGTTGCTTTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-914s21c1
Sequence:GTACCGGTGGAATGTGTAACCAATATTTCTCGAGAAATATTGGTTACACATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003931.2-1102s21c1
Sequence:GTACCGGGAATTGTCTTTGCAAGATATACTCGAGTATATCTTGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks