EMAIL THIS PAGE TO A FRIEND

WASF2

WAS protein family, member 2

Synonyms: IMD2 SCAR2 WASF4 WAVE2 dJ393P12.2
UniProtKB ID: Q9Y6W5, B4DZN0, O60794, Q9UDY7
Gene ID:
Human(10163) Summary: This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(242687) WAS protein family, member 2
Rat(313024) WAS protein family, member 2
cow(504482) WAS protein family, member 2
sheep(101107336) WAS protein family, member 2
naked mole-rat(101701848) WAS protein family, member 2
domestic guinea pig(100723274) WAS protein family, member 2
Zebrafish(394056) WAS protein family, member 2
dog(487343) WAS protein family, member 2
domestic cat(101082837) WAS protein family, member 2
chicken(426359) WAS protein family, member 2
Gene Class: Cytoskeleton
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006990 Rosetta Predictions human pricing
NM_001013167 Rosetta Predictions rat pricing
NM_153423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342733 predicted 1663
2 SASI_Hs02_00342734 predicted 889
3 SASI_Hs02_00342735 predicted 1663
4 SASI_Hs02_00342736 predicted 908
5 SASI_Hs02_00342737 predicted 1657
6 SASI_Hs02_00342738 predicted 765
7 SASI_Hs02_00342739 predicted 564
8 SASI_Hs02_00342740 predicted 667
9 SASI_Hs02_00342741 predicted 512
10 SASI_Hs02_00342742 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033062 predicted 618
2 SASI_Rn01_00033063 predicted 430
3 SASI_Rn01_00033064 predicted 905
4 SASI_Rn01_00033065 predicted 750
5 SASI_Rn01_00033066 predicted 409
6 SASI_Rn01_00033067 predicted 832
7 SASI_Rn01_00033068 predicted 356
8 SASI_Rn01_00033069 predicted 415
9 SASI_Rn01_00033070 predicted 392
10 SASI_Rn01_00033071 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113510 predicted 695
2 SASI_Mm01_00113511 predicted 495
3 SASI_Mm01_00113512 predicted 566
4 SASI_Mm02_00343225 predicted 389
5 SASI_Mm01_00113514 predicted 702
6 SASI_Mm01_00113515 predicted 680
7 SASI_Mm01_00113516 predicted 292
8 SASI_Mm01_00113517 predicted 805
9 SASI_Mm01_00113518 predicted 685
10 SASI_Mm01_00113519 predicted 685
11 SASI_Mm01_00113513 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006990
WASF2 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-374s21c1
Sequence:GTACCGGAGCTCTTTACTCAGGCAAATACTCGAGTATTTGCCTGAGTAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-431s21c1
Sequence:GTACCGGTCGACCGACTACAGGTTAAAGCTCGAGCTTTAACCTGTAGTCGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006990.2-1871s21c1
Sequence:GTACCGGTCCTCCAAGTCAACATGTATTCTCGAGAATACATGTTGACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-302s21c1
Sequence:GTACCGGCCAACATCACCCTGGCAAATGCTCGAGCATTTGCCAGGGTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-668s21c1
Sequence:GTACCGGCAGACCCTTCATACTTCTTTGCTCGAGCAAAGAAGTATGAAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-893s21c1
Sequence:GTACCGGCCACTTTGGTGTACCAGAATGCTCGAGCATTCTGGTACACCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-1694s21c1
Sequence:GTACCGGAGGACGACTGGTCCGATTAACCTCGAGGTTAATCGGACCAGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006990.2-2050s1c1
Sequence:CCGGGCCATATTCAACTACAGCCTTCTCGAGAAGGCTGTAGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-571s1c1
Sequence:CCGGCCTGTCTTAGAAACATACAATCTCGAGATTGTATGTTTCTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1053s1c1
Sequence:CCGGCAACCAAAGAGGATCTGGTTTCTCGAGAAACCAGATCCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1046s1c1
Sequence:CCGGCAGTGGACAACCAAAGAGGATCTCGAGATCCTCTTTGGTTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-430s1c1
Sequence:CCGGGTCGACCGACTACAGGTTAAACTCGAGTTTAACCTGTAGTCGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006990
WASF2 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-374s21c1
Sequence:GTACCGGAGCTCTTTACTCAGGCAAATACTCGAGTATTTGCCTGAGTAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-431s21c1
Sequence:GTACCGGTCGACCGACTACAGGTTAAAGCTCGAGCTTTAACCTGTAGTCGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006990.2-1871s21c1
Sequence:GTACCGGTCCTCCAAGTCAACATGTATTCTCGAGAATACATGTTGACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-302s21c1
Sequence:GTACCGGCCAACATCACCCTGGCAAATGCTCGAGCATTTGCCAGGGTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-668s21c1
Sequence:GTACCGGCAGACCCTTCATACTTCTTTGCTCGAGCAAAGAAGTATGAAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-893s21c1
Sequence:GTACCGGCCACTTTGGTGTACCAGAATGCTCGAGCATTCTGGTACACCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-1694s21c1
Sequence:GTACCGGAGGACGACTGGTCCGATTAACCTCGAGGTTAATCGGACCAGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006990.2-2050s1c1
Sequence:CCGGGCCATATTCAACTACAGCCTTCTCGAGAAGGCTGTAGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-571s1c1
Sequence:CCGGCCTGTCTTAGAAACATACAATCTCGAGATTGTATGTTTCTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1053s1c1
Sequence:CCGGCAACCAAAGAGGATCTGGTTTCTCGAGAAACCAGATCCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1046s1c1
Sequence:CCGGCAGTGGACAACCAAAGAGGATCTCGAGATCCTCTTTGGTTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-430s1c1
Sequence:CCGGGTCGACCGACTACAGGTTAAACTCGAGTTTAACCTGTAGTCGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006990
WASF2 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-374s21c1
Sequence:GTACCGGAGCTCTTTACTCAGGCAAATACTCGAGTATTTGCCTGAGTAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-431s21c1
Sequence:GTACCGGTCGACCGACTACAGGTTAAAGCTCGAGCTTTAACCTGTAGTCGGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006990.2-1871s21c1
Sequence:GTACCGGTCCTCCAAGTCAACATGTATTCTCGAGAATACATGTTGACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-302s21c1
Sequence:GTACCGGCCAACATCACCCTGGCAAATGCTCGAGCATTTGCCAGGGTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-668s21c1
Sequence:GTACCGGCAGACCCTTCATACTTCTTTGCTCGAGCAAAGAAGTATGAAGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-893s21c1
Sequence:GTACCGGCCACTTTGGTGTACCAGAATGCTCGAGCATTCTGGTACACCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006990.2-1694s21c1
Sequence:GTACCGGAGGACGACTGGTCCGATTAACCTCGAGGTTAATCGGACCAGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006990.2-2050s1c1
Sequence:CCGGGCCATATTCAACTACAGCCTTCTCGAGAAGGCTGTAGTTGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-571s1c1
Sequence:CCGGCCTGTCTTAGAAACATACAATCTCGAGATTGTATGTTTCTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1053s1c1
Sequence:CCGGCAACCAAAGAGGATCTGGTTTCTCGAGAAACCAGATCCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-1046s1c1
Sequence:CCGGCAGTGGACAACCAAAGAGGATCTCGAGATCCTCTTTGGTTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006990.2-430s1c1
Sequence:CCGGGTCGACCGACTACAGGTTAAACTCGAGTTTAACCTGTAGTCGGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153423
VALIDATED
WASF2 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-595s21c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-1586s21c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153423.6-3063s21c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-268s21c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-492s21c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-3064s1c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-596s1c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-493s1c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-1587s1c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-269s1c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153423
VALIDATED
WASF2 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-595s21c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-1586s21c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153423.6-3063s21c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-268s21c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-492s21c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-3064s1c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-596s1c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-493s1c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-1587s1c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-269s1c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153423
VALIDATED
WASF2 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-595s21c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-1586s21c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153423.6-3063s21c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-268s21c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153423.6-492s21c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-3064s1c1
Sequence:CCGGCGGGTGTTATTATTCAGGAAACTCGAGTTTCCTGAATAATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-596s1c1
Sequence:CCGGCCCTCATACTTCTTTGATCTTCTCGAGAAGATCAAAGAAGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-493s1c1
Sequence:CCGGGCCCGTCTTAGAGACCTATAACTCGAGTTATAGGTCTCTAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-1587s1c1
Sequence:CCGGCGGAAGATGATTCTTCTGAATCTCGAGATTCAGAAGAATCATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153423.3-269s1c1
Sequence:CCGGAGTAAGTATGCAGAGGACATTCTCGAGAATGTCCTCTGCATACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks