EMAIL THIS PAGE TO A FRIEND

WASF3

WAS protein family, member 3

Synonyms: Brush-1 SCAR3 WAVE3
UniProtKB ID: Q9UPY6, O94974
Gene ID:
Human(10810) Summary: This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. [provided by RefSeq, Jul 2008]
Mouse(245880) WAS protein family, member 3
Rat(682937) WAS protein family, member 3
Zebrafish(563632) WAS protein family, member 3
Horse(100050895) WAS protein family, member 3
domestic cat(101086527) WAS protein family, member 3
dog(477331) WAS protein family, member 3
chicken(418934) WAS protein family, member 3
domestic guinea pig(100718803) WAS protein family, member 3
naked mole-rat(101719051) WAS protein family, member 3
Domestic Rabbit(100353601) WAS protein family, member 3
cow(540674) WAS protein family, member 3
sheep(101114880) WAS protein family, member 3
Gene Class: Cytoskeleton
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006646 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084471 MISSION® esiRNA esiRNA human WASF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006646 Rosetta Predictions human pricing
XM_001061259 Rosetta Predictions rat pricing
NM_145155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172997 predicted 1795
2 SASI_Hs01_00172998 predicted 1802
3 SASI_Hs01_00173000 predicted 489
4 SASI_Hs01_00173001 predicted 392
5 SASI_Hs02_00342014 predicted 421
6 SASI_Hs01_00173002 predicted 577
7 SASI_Hs01_00173003 predicted 364
8 SASI_Hs01_00173004 predicted 1563
9 SASI_Hs01_00173005 predicted 840
10 SASI_Hs01_00173006 predicted 869
11 SASI_Hs01_00172999 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299391 predicted 580
2 SASI_Rn02_00299392 predicted 2019
3 SASI_Rn02_00299393 predicted 604
4 SASI_Rn02_00299394 predicted 1166
5 SASI_Rn02_00299395 predicted 2020
6 SASI_Rn02_00299396 predicted 1039
7 SASI_Rn02_00299397 predicted 765
8 SASI_Rn02_00299398 predicted 1065
9 SASI_Rn02_00299399 predicted 484
10 SASI_Rn02_00299400 predicted 2022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340583 predicted 642
2 SASI_Mm01_00174819 predicted 2017
3 SASI_Mm01_00174820 predicted 2024
4 SASI_Mm01_00174821 predicted 2018
5 SASI_Mm01_00174822 predicted 597
6 SASI_Mm01_00174823 predicted 1039
7 SASI_Mm01_00174824 predicted 1915
8 SASI_Mm01_00174825 predicted 1058
9 SASI_Mm01_00174827 predicted 765
10 SASI_Mm01_00174828 predicted 1726
11 SASI_Mm01_00174826 predicted 1422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145155
WASF3 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145155.1-2031s1c1
Sequence:CCGGCCCTGTAGCTTTAGTCCCTTTCTCGAGAAAGGGACTAAAGCTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1168s1c1
Sequence:CCGGCCGATTATTCTTATCCTGCTACTCGAGTAGCAGGATAAGAATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-785s1c1
Sequence:CCGGCAACCCTGTTGCTGACATTTACTCGAGTAAATGTCAGCAACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1041s1c1
Sequence:CCGGGAGTGGAATATGATGGCGTATCTCGAGATACGCCATCATATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-784s1c1
Sequence:CCGGCCAACCCTGTTGCTGACATTTCTCGAGAAATGTCAGCAACAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-788s21c1
Sequence:GTACCGGCCCTGTTGCTGACATTTATAACTCGAGTTATAAATGTCAGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1156s21c1
Sequence:GTACCGGCATCCGATGTCACCGATTATTCTCGAGAATAATCGGTGACATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1416s21c1
Sequence:GTACCGGATGCTTCCAGCACAGATAATTCTCGAGAATTATCTGTGCTGGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-614s21c1
Sequence:GTACCGGCTTCTACATCAGAGCAAATTCCTCGAGGAATTTGCTCTGATGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2011s21c1
Sequence:GTACCGGGCACCCTCACAGTGGTATTTCCTCGAGGAAATACCACTGTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2152s21c1
Sequence:GTACCGGCACCAGGAAACTCGCAGTATTCTCGAGAATACTGCGAGTTTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145155
WASF3 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145155.1-2031s1c1
Sequence:CCGGCCCTGTAGCTTTAGTCCCTTTCTCGAGAAAGGGACTAAAGCTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1168s1c1
Sequence:CCGGCCGATTATTCTTATCCTGCTACTCGAGTAGCAGGATAAGAATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-785s1c1
Sequence:CCGGCAACCCTGTTGCTGACATTTACTCGAGTAAATGTCAGCAACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1041s1c1
Sequence:CCGGGAGTGGAATATGATGGCGTATCTCGAGATACGCCATCATATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-784s1c1
Sequence:CCGGCCAACCCTGTTGCTGACATTTCTCGAGAAATGTCAGCAACAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-788s21c1
Sequence:GTACCGGCCCTGTTGCTGACATTTATAACTCGAGTTATAAATGTCAGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1156s21c1
Sequence:GTACCGGCATCCGATGTCACCGATTATTCTCGAGAATAATCGGTGACATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1416s21c1
Sequence:GTACCGGATGCTTCCAGCACAGATAATTCTCGAGAATTATCTGTGCTGGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-614s21c1
Sequence:GTACCGGCTTCTACATCAGAGCAAATTCCTCGAGGAATTTGCTCTGATGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2011s21c1
Sequence:GTACCGGGCACCCTCACAGTGGTATTTCCTCGAGGAAATACCACTGTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2152s21c1
Sequence:GTACCGGCACCAGGAAACTCGCAGTATTCTCGAGAATACTGCGAGTTTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145155
WASF3 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145155.1-2031s1c1
Sequence:CCGGCCCTGTAGCTTTAGTCCCTTTCTCGAGAAAGGGACTAAAGCTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1168s1c1
Sequence:CCGGCCGATTATTCTTATCCTGCTACTCGAGTAGCAGGATAAGAATAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-785s1c1
Sequence:CCGGCAACCCTGTTGCTGACATTTACTCGAGTAAATGTCAGCAACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-1041s1c1
Sequence:CCGGGAGTGGAATATGATGGCGTATCTCGAGATACGCCATCATATTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145155.1-784s1c1
Sequence:CCGGCCAACCCTGTTGCTGACATTTCTCGAGAAATGTCAGCAACAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-788s21c1
Sequence:GTACCGGCCCTGTTGCTGACATTTATAACTCGAGTTATAAATGTCAGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1156s21c1
Sequence:GTACCGGCATCCGATGTCACCGATTATTCTCGAGAATAATCGGTGACATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-1416s21c1
Sequence:GTACCGGATGCTTCCAGCACAGATAATTCTCGAGAATTATCTGTGCTGGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145155.3-614s21c1
Sequence:GTACCGGCTTCTACATCAGAGCAAATTCCTCGAGGAATTTGCTCTGATGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2011s21c1
Sequence:GTACCGGGCACCCTCACAGTGGTATTTCCTCGAGGAAATACCACTGTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145155.3-2152s21c1
Sequence:GTACCGGCACCAGGAAACTCGCAGTATTCTCGAGAATACTGCGAGTTTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006646
VALIDATED
WASF3 MISSION shRNA Bacterial Glycerol Stock
WAS protein family, member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-3644s1c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006646.4-1561s1c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006646.4-360s1c1
Sequence:CCGGGCAAACATGCTGAAGACATATCTCGAGATATGTCTTCAGCATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-1217s1c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-294s1c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-578s21c1
Sequence:GTACCGGCTAATCCTGTTGCTGATATTTCTCGAGAAATATCAGCAACAGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-3643s21c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1216s21c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1560s21c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006646.5-293s21c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-949s21c1
Sequence:GTACCGGGCATCGGACGTTACGGATTACCTCGAGGTAATCCGTAACGTCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006646
VALIDATED
WASF3 MISSION shRNA shRNA Plasmid DNA
WAS protein family, member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-3644s1c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006646.4-1561s1c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006646.4-360s1c1
Sequence:CCGGGCAAACATGCTGAAGACATATCTCGAGATATGTCTTCAGCATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-1217s1c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-294s1c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-578s21c1
Sequence:GTACCGGCTAATCCTGTTGCTGATATTTCTCGAGAAATATCAGCAACAGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-3643s21c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1216s21c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1560s21c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006646.5-293s21c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-949s21c1
Sequence:GTACCGGGCATCGGACGTTACGGATTACCTCGAGGTAATCCGTAACGTCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006646
VALIDATED
WASF3 MISSION shRNA Lentiviral Transduction Particles
WAS protein family, member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-3644s1c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006646.4-1561s1c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006646.4-360s1c1
Sequence:CCGGGCAAACATGCTGAAGACATATCTCGAGATATGTCTTCAGCATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-1217s1c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006646.4-294s1c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-578s21c1
Sequence:GTACCGGCTAATCCTGTTGCTGATATTTCTCGAGAAATATCAGCAACAGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-3643s21c1
Sequence:CCGGGCCTACTACATTGGCGCTATTCTCGAGAATAGCGCCAATGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1216s21c1
Sequence:CCGGCCAGCGCAGATAATTGAGTATCTCGAGATACTCAATTATCTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-1560s21c1
Sequence:CCGGCGCTGCTATTCGAATGGGAATCTCGAGATTCCCATTCGAATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006646.5-293s21c1
Sequence:CCGGCCAGCGAACTTGAATGTGTAACTCGAGTTACACATTCAAGTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006646.5-949s21c1
Sequence:GTACCGGGCATCGGACGTTACGGATTACCTCGAGGTAATCCGTAACGTCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks