EMAIL THIS PAGE TO A FRIEND

WASH2P

WAS protein family homolog 2 pseudogene

Synonyms: FAM39B
Species: Human WASH2P(375260)
UniProtKB ID: Q6VEQ5
Gene ID:
Gene Class: Cytoskeleton
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198943 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153191 MISSION® esiRNA esiRNA human WASH2P (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040204 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516849 predicted 2761
2 SASI_Hs02_00516850 predicted 3131
3 SASI_Hs02_00516851 predicted 2930
4 SASI_Hs02_00516852 predicted 2944
5 SASI_Hs02_00516853 predicted 3276
6 SASI_Hs02_00516854 predicted 2760
7 SASI_Hs02_00516855 predicted 1414
8 SASI_Hs02_00516856 predicted 3296
9 SASI_Hs02_00516857 predicted 1418
10 SASI_Hs02_00516858 predicted 2549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198943
WASH2P MISSION shRNA Bacterial Glycerol Stock
WAS protein family homolog 2 pseudogene
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1187s1c1
Sequence:CCGGGCTGGAGAAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-701s1c1
Sequence:CCGGCCCAGAGAACTACTTCTATGTCTCGAGACATAGAAGTAGTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-248s1c1
Sequence:CCGGGAAGATCAAGGGCAGCAAGAACTCGAGTTCTTGCTGCCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-317s1c1
Sequence:CCGGGCAGGAATATGGCTCCATCTTCTCGAGAAGATGGAGCCATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-705s1c1
Sequence:CCGGGAGAACTACTTCTATGTGCCACTCGAGTGGCACATAGAAGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1250s1c1
Sequence:CCGGGATGTCGGATCTCTTCAACAACTCGAGTTGTTGAAGAGATCCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-554s1c1
Sequence:CCGGCGAGAACCTGTACAAGAAGTACTCGAGTACTTCTTGTACAGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198943
WASH2P MISSION shRNA shRNA Plasmid DNA
WAS protein family homolog 2 pseudogene
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1187s1c1
Sequence:CCGGGCTGGAGAAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-701s1c1
Sequence:CCGGCCCAGAGAACTACTTCTATGTCTCGAGACATAGAAGTAGTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-248s1c1
Sequence:CCGGGAAGATCAAGGGCAGCAAGAACTCGAGTTCTTGCTGCCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-317s1c1
Sequence:CCGGGCAGGAATATGGCTCCATCTTCTCGAGAAGATGGAGCCATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-705s1c1
Sequence:CCGGGAGAACTACTTCTATGTGCCACTCGAGTGGCACATAGAAGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1250s1c1
Sequence:CCGGGATGTCGGATCTCTTCAACAACTCGAGTTGTTGAAGAGATCCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-554s1c1
Sequence:CCGGCGAGAACCTGTACAAGAAGTACTCGAGTACTTCTTGTACAGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198943
WASH2P MISSION shRNA Lentiviral Transduction Particles
WAS protein family homolog 2 pseudogene
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1187s1c1
Sequence:CCGGGCTGGAGAAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-701s1c1
Sequence:CCGGCCCAGAGAACTACTTCTATGTCTCGAGACATAGAAGTAGTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-248s1c1
Sequence:CCGGGAAGATCAAGGGCAGCAAGAACTCGAGTTCTTGCTGCCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-317s1c1
Sequence:CCGGGCAGGAATATGGCTCCATCTTCTCGAGAAGATGGAGCCATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198943.1-705s1c1
Sequence:CCGGGAGAACTACTTCTATGTGCCACTCGAGTGGCACATAGAAGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-1250s1c1
Sequence:CCGGGATGTCGGATCTCTTCAACAACTCGAGTTGTTGAAGAGATCCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198943.1-554s1c1
Sequence:CCGGCGAGAACCTGTACAAGAAGTACTCGAGTACTTCTTGTACAGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks