EMAIL THIS PAGE TO A FRIEND

WASH3P

WAS protein family homolog 3 pseudogene

Synonyms: FAM39DP
Species: Human WASH3P(374666)
UniProtKB ID: C4AMC7
Gene ID:
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199163 Rosetta Predictions human pricing
NR_003659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135519 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379969 predicted 1224
2 SASI_Hs02_00379970 predicted 965
3 SASI_Hs02_00379971 predicted 2122
4 SASI_Hs02_00379972 predicted 1231
5 SASI_Hs02_00379973 predicted 1354
6 SASI_Hs02_00379974 predicted 1033
7 SASI_Hs02_00379975 predicted 2032
8 SASI_Hs02_00379976 predicted 1480
9 SASI_Hs02_00379977 predicted 1240
10 SASI_Hs02_00379978 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199163
WASH3P MISSION shRNA Bacterial Glycerol Stock
WAS protein family homolog 3 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1491s1c1
Sequence:CCGGGTCCCAGAGAACTACTTCTATCTCGAGATAGAAGTAGTTCTCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1574s1c1
Sequence:CCGGCATTACCAACGACCTCATGTACTCGAGTACATGAGGTCGTTGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1037s1c1
Sequence:CCGGCCAGGCCAAGATTGAGAAGATCTCGAGATCTTCTCAATCTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1343s1c1
Sequence:CCGGCACCGAGAACCTGTAGAAGAACTCGAGTTCTTCTACAGGTTCTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-2023s1c1
Sequence:CCGGGCACTTGATGTCGGATCTCTTCTCGAGAAGAGATCCGACATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199163
WASH3P MISSION shRNA shRNA Plasmid DNA
WAS protein family homolog 3 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1491s1c1
Sequence:CCGGGTCCCAGAGAACTACTTCTATCTCGAGATAGAAGTAGTTCTCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1574s1c1
Sequence:CCGGCATTACCAACGACCTCATGTACTCGAGTACATGAGGTCGTTGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1037s1c1
Sequence:CCGGCCAGGCCAAGATTGAGAAGATCTCGAGATCTTCTCAATCTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1343s1c1
Sequence:CCGGCACCGAGAACCTGTAGAAGAACTCGAGTTCTTCTACAGGTTCTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-2023s1c1
Sequence:CCGGGCACTTGATGTCGGATCTCTTCTCGAGAAGAGATCCGACATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199163
WASH3P MISSION shRNA Lentiviral Transduction Particles
WAS protein family homolog 3 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168461    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1491s1c1
Sequence:CCGGGTCCCAGAGAACTACTTCTATCTCGAGATAGAAGTAGTTCTCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1574s1c1
Sequence:CCGGCATTACCAACGACCTCATGTACTCGAGTACATGAGGTCGTTGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1037s1c1
Sequence:CCGGCCAGGCCAAGATTGAGAAGATCTCGAGATCTTCTCAATCTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-1343s1c1
Sequence:CCGGCACCGAGAACCTGTAGAAGAACTCGAGTTCTTCTACAGGTTCTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199163.2-2023s1c1
Sequence:CCGGGCACTTGATGTCGGATCTCTTCTCGAGAAGAGATCCGACATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks