EMAIL THIS PAGE TO A FRIEND

WASH5P

WAS protein family homolog 5 pseudogene

Species: Human WASH5P(375690)
Gene ID:
289 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002689 Anti-WASH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182905 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114391 MISSION® esiRNA esiRNA human FAM39B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182905 Rosetta Predictions human pricing
XM_926088 Rosetta Predictions human pricing
XM_930604 Rosetta Predictions human pricing
XM_930619 Rosetta Predictions human pricing
XM_930631 Rosetta Predictions human pricing
XM_930643 Rosetta Predictions human pricing
XM_930659 Rosetta Predictions human pricing
XM_930674 Rosetta Predictions human pricing
XM_930687 Rosetta Predictions human pricing
XM_930700 Rosetta Predictions human pricing
XM_930711 Rosetta Predictions human pricing
XM_930724 Rosetta Predictions human pricing
XM_930734 Rosetta Predictions human pricing
XM_930763 Rosetta Predictions human pricing
XM_930773 Rosetta Predictions human pricing
XM_930782 Rosetta Predictions human pricing
XM_930792 Rosetta Predictions human pricing
XM_930803 Rosetta Predictions human pricing
XM_930816 Rosetta Predictions human pricing
XM_930839 Rosetta Predictions human pricing
XM_930847 Rosetta Predictions human pricing
XM_930858 Rosetta Predictions human pricing
XM_930868 Rosetta Predictions human pricing
XM_930877 Rosetta Predictions human pricing
XM_930885 Rosetta Predictions human pricing
XM_930896 Rosetta Predictions human pricing
XM_930901 Rosetta Predictions human pricing
XM_930907 Rosetta Predictions human pricing
XM_930913 Rosetta Predictions human pricing
XM_930924 Rosetta Predictions human pricing
XM_930933 Rosetta Predictions human pricing
XM_930941 Rosetta Predictions human pricing
XM_930947 Rosetta Predictions human pricing
XM_930957 Rosetta Predictions human pricing
XM_930965 Rosetta Predictions human pricing
XM_930971 Rosetta Predictions human pricing
XM_930979 Rosetta Predictions human pricing
XM_930989 Rosetta Predictions human pricing
XM_930998 Rosetta Predictions human pricing
XM_931007 Rosetta Predictions human pricing
XM_931012 Rosetta Predictions human pricing
XM_931018 Rosetta Predictions human pricing
XM_931024 Rosetta Predictions human pricing
XM_931031 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371002 predicted 563
2 SASI_Hs02_00371003 predicted 284
3 SASI_Hs02_00371004 predicted 675
4 SASI_Hs02_00371005 predicted 677
5 SASI_Hs02_00371006 predicted 275
6 SASI_Hs01_00034662 predicted 809
7 SASI_Hs02_00371007 predicted 669
8 SASI_Hs02_00371008 predicted 323
9 SASI_Hs02_00371009 predicted 563
10 SASI_Hs02_00371010 predicted 359
11 SASI_Hs01_00034660 predicted 118
12 SASI_Hs01_00034661 predicted 271
13 SASI_Hs01_00034663 predicted 123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278314 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296821 predicted 992
2 SASI_Hs01_00296822 predicted 1475
3 SASI_Hs01_00296823 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265516 predicted 7633
2 SASI_Hs01_00265517 predicted 7641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270191 predicted 1959
2 SASI_Hs01_00270192 predicted 1662
3 SASI_Hs01_00270193 predicted 1959
4 SASI_Hs01_00270194 predicted 1954
5 SASI_Hs01_00270195 predicted 1900
6 SASI_Hs01_00270196 predicted 1950
7 SASI_Hs01_00270197 predicted 1671
8 SASI_Hs01_00270198 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265526 predicted 7274
2 SASI_Hs01_00265527 predicted 7283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297518 predicted 1019
2 SASI_Hs01_00297519 predicted 1014
3 SASI_Hs01_00297520 predicted 896
4 SASI_Hs01_00297521 predicted 1149
5 SASI_Hs01_00297522 predicted 894
6 SASI_Hs01_00297523 predicted 915
7 SASI_Hs01_00297524 predicted 943
8 SASI_Hs01_00297525 predicted 1143
9 SASI_Hs01_00297526 predicted 1110
10 SASI_Hs01_00297527 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271867 predicted 306
2 SASI_Hs01_00271868 predicted 603
3 SASI_Hs01_00271869 predicted 599
4 SASI_Hs01_00271870 predicted 292
5 SASI_Hs01_00271871 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283970 predicted 773
2 SASI_Hs01_00283971 predicted 787
3 SASI_Hs01_00283972 predicted 543
4 SASI_Hs01_00283973 predicted 547
5 SASI_Hs01_00283974 predicted 631
6 SASI_Hs01_00283975 predicted 631
7 SASI_Hs01_00283976 predicted 746
8 SASI_Hs01_00283977 predicted 798
9 SASI_Hs01_00283978 predicted 721
10 SASI_Hs01_00283979 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259324 predicted 306
2 SASI_Hs01_00259325 predicted 605
3 SASI_Hs01_00259326 predicted 311
4 SASI_Hs01_00259327 predicted 320
5 SASI_Hs01_00259328 predicted 601
6 SASI_Hs01_00259329 predicted 405
7 SASI_Hs01_00259330 predicted 295
8 SASI_Hs01_00259331 predicted 295
9 SASI_Hs01_00259332 predicted 429
10 SASI_Hs01_00259333 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258344 predicted 777
2 SASI_Hs01_00258345 predicted 1077
3 SASI_Hs01_00258346 predicted 789
4 SASI_Hs01_00258347 predicted 541
5 SASI_Hs01_00258348 predicted 1087
6 SASI_Hs01_00258349 predicted 556
7 SASI_Hs01_00258350 predicted 628
8 SASI_Hs01_00258351 predicted 627
9 SASI_Hs01_00258352 predicted 748
10 SASI_Hs01_00258353 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251910 predicted 1307
2 SASI_Hs01_00251911 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251521 predicted 1817
2 SASI_Hs01_00251522 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273442 predicted 8758
2 SASI_Hs01_00273443 predicted 8768
3 SASI_Hs01_00273444 predicted 9052
4 SASI_Hs01_00273445 predicted 9017
5 SASI_Hs01_00273446 predicted 9060
6 SASI_Hs01_00273447 predicted 9051
7 SASI_Hs01_00273448 predicted 8987
8 SASI_Hs01_00273449 predicted 9043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289692 predicted 9297
2 SASI_Hs01_00289693 predicted 9620
3 SASI_Hs01_00289694 predicted 9613
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300065 predicted 9528
2 SASI_Hs01_00300066 predicted 9530
3 SASI_Hs01_00300067 predicted 9822
4 SASI_Hs01_00300068 predicted 9785
5 SASI_Hs01_00300069 predicted 9825
6 SASI_Hs01_00300070 predicted 9809
7 SASI_Hs01_00300071 predicted 9752
8 SASI_Hs01_00300072 predicted 9814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295649 predicted 6767
2 SASI_Hs01_00295650 predicted 6770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274840 predicted 7463
2 SASI_Hs01_00274841 predicted 7630
3 SASI_Hs01_00274842 predicted 7550
4 SASI_Hs01_00274843 predicted 7646
5 SASI_Hs01_00274844 predicted 7484
6 SASI_Hs01_00274845 predicted 7554
7 SASI_Hs01_00274846 predicted 7639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274866 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254384 predicted 9717
2 SASI_Hs01_00254385 predicted 9300
3 SASI_Hs01_00254386 predicted 9720
4 SASI_Hs01_00254387 predicted 9366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256030 predicted 2201
2 SASI_Hs01_00256031 predicted 4802
3 SASI_Hs01_00256032 predicted 5929
4 SASI_Hs01_00256033 predicted 2430
5 SASI_Hs01_00256034 predicted 5856
6 SASI_Hs01_00256035 predicted 3134
7 SASI_Hs01_00256036 predicted 3126
8 SASI_Hs01_00256037 predicted 9935
9 SASI_Hs01_00256038 predicted 996
10 SASI_Hs01_00256039 predicted 8338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263442 predicted 2115
2 SASI_Hs01_00263443 predicted 4717
3 SASI_Hs01_00263444 predicted 5843
4 SASI_Hs01_00263445 predicted 2348
5 SASI_Hs01_00263446 predicted 5769
6 SASI_Hs01_00263447 predicted 3047
7 SASI_Hs01_00263448 predicted 3033
8 SASI_Hs01_00263449 predicted 9846
9 SASI_Hs01_00263450 predicted 913
10 SASI_Hs01_00263451 predicted 8260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281864 predicted 8263
2 SASI_Hs01_00281865 predicted 8270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264969 predicted 6772
2 SASI_Hs01_00264970 predicted 7080
3 SASI_Hs01_00264971 predicted 6780
4 SASI_Hs01_00264972 predicted 6538
5 SASI_Hs01_00264973 predicted 7077
6 SASI_Hs01_00264974 predicted 6554
7 SASI_Hs01_00264975 predicted 6626
8 SASI_Hs01_00264976 predicted 6623
9 SASI_Hs01_00264977 predicted 6745
10 SASI_Hs01_00264978 predicted 7080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259013 predicted 7825
2 SASI_Hs01_00259014 predicted 7701
3 SASI_Hs01_00259015 predicted 7952
4 SASI_Hs01_00259016 predicted 7699
5 SASI_Hs01_00259017 predicted 7717
6 SASI_Hs01_00259018 predicted 7809
7 SASI_Hs01_00259019 predicted 7695
8 SASI_Hs01_00259020 predicted 7814
9 SASI_Hs01_00259021 predicted 7661
10 SASI_Hs01_00259022 predicted 7658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278875 predicted 9779
2 SASI_Hs01_00278876 predicted 9787
3 SASI_Hs01_00278877 predicted 10075
4 SASI_Hs01_00278878 predicted 10044
5 SASI_Hs01_00278879 predicted 10084
6 SASI_Hs01_00278880 predicted 10070
7 SASI_Hs01_00278881 predicted 10009
8 SASI_Hs01_00278882 predicted 10066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284399 predicted 8613
2 SASI_Hs01_00284400 predicted 8601
3 SASI_Hs01_00284401 predicted 8497
4 SASI_Hs01_00284402 predicted 8738
5 SASI_Hs01_00284403 predicted 8490
6 SASI_Hs01_00284404 predicted 8508
7 SASI_Hs01_00284405 predicted 8528
8 SASI_Hs01_00284406 predicted 8737
9 SASI_Hs01_00284407 predicted 8696
10 SASI_Hs01_00284408 predicted 8610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299439 predicted 9402
2 SASI_Hs01_00299440 predicted 9405
3 SASI_Hs01_00299441 predicted 9694
4 SASI_Hs01_00299442 predicted 9663
5 SASI_Hs01_00299443 predicted 9700
6 SASI_Hs01_00299444 predicted 9686
7 SASI_Hs01_00299445 predicted 9628
8 SASI_Hs01_00299446 predicted 9684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251059 predicted 10337
2 SASI_Hs01_00251060 predicted 10338
3 SASI_Hs01_00251061 predicted 10625
4 SASI_Hs01_00251062 predicted 10587
5 SASI_Hs01_00251063 predicted 10635
6 SASI_Hs01_00251064 predicted 10623
7 SASI_Hs01_00251065 predicted 10566
8 SASI_Hs01_00251066 predicted 10623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298271 predicted 7976
2 SASI_Hs01_00298272 predicted 7977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254828 predicted 7957
2 SASI_Hs01_00254829 predicted 7759
3 SASI_Hs01_00254830 predicted 7768
4 SASI_Hs01_00254831 predicted 7937
5 SASI_Hs01_00254832 predicted 7809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277209 predicted 8442
2 SASI_Hs01_00277210 predicted 8320
3 SASI_Hs01_00277211 predicted 8562
4 SASI_Hs01_00277212 predicted 8316
5 SASI_Hs01_00277213 predicted 8333
6 SASI_Hs01_00277214 predicted 8436
7 SASI_Hs01_00277215 predicted 8306
8 SASI_Hs01_00277216 predicted 8431
9 SASI_Hs01_00277217 predicted 8276
10 SASI_Hs01_00277218 predicted 8278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264167 predicted 7970
2 SASI_Hs01_00264168 predicted 7951
3 SASI_Hs01_00264169 predicted 7766
4 SASI_Hs01_00264170 predicted 7771
5 SASI_Hs01_00264171 predicted 7990
6 SASI_Hs01_00264172 predicted 8020
7 SASI_Hs01_00264173 predicted 7951
8 SASI_Hs01_00264174 predicted 8125
9 SASI_Hs01_00264175 predicted 7807
10 SASI_Hs01_00264176 predicted 7961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254364 predicted 8062
2 SASI_Hs01_00254365 predicted 7936
3 SASI_Hs01_00254366 predicted 8187
4 SASI_Hs01_00254367 predicted 7930
5 SASI_Hs01_00254368 predicted 7947
6 SASI_Hs01_00254369 predicted 8054
7 SASI_Hs01_00254370 predicted 7927
8 SASI_Hs01_00254371 predicted 8052
9 SASI_Hs01_00254372 predicted 7897
10 SASI_Hs01_00254373 predicted 7894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260670 predicted 7577
2 SASI_Hs01_00260671 predicted 7672
3 SASI_Hs01_00260672 predicted 7652
4 SASI_Hs01_00260673 predicted 7735
5 SASI_Hs01_00260674 predicted 7653
6 SASI_Hs01_00260675 predicted 7609
7 SASI_Hs01_00260676 predicted 7601
8 SASI_Hs01_00260677 predicted 7620
9 SASI_Hs01_00260678 predicted 7741
10 SASI_Hs01_00260679 predicted 7757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255122 predicted 7822
2 SASI_Hs01_00255123 predicted 7703
3 SASI_Hs01_00255124 predicted 7946
4 SASI_Hs01_00255125 predicted 7697
5 SASI_Hs01_00255126 predicted 7715
6 SASI_Hs01_00255127 predicted 7689
7 SASI_Hs01_00255128 predicted 7814
8 SASI_Hs01_00255129 predicted 7659
9 SASI_Hs01_00255130 predicted 7660
10 SASI_Hs01_00255131 predicted 7597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251912 predicted 7817
2 SASI_Hs01_00251913 predicted 7702
3 SASI_Hs01_00251914 predicted 7946
4 SASI_Hs01_00251915 predicted 7692
5 SASI_Hs01_00251916 predicted 7717
6 SASI_Hs01_00251917 predicted 7816
7 SASI_Hs01_00251918 predicted 7686
8 SASI_Hs01_00251919 predicted 7807
9 SASI_Hs01_00251920 predicted 7659
10 SASI_Hs01_00251921 predicted 7657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296834 predicted 9022
2 SASI_Hs01_00296835 predicted 9027
3 SASI_Hs01_00296836 predicted 9321
4 SASI_Hs01_00296837 predicted 9286
5 SASI_Hs01_00296838 predicted 9318
6 SASI_Hs01_00296839 predicted 9311
7 SASI_Hs01_00296840 predicted 9254
8 SASI_Hs01_00296841 predicted 9313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285236 predicted 7982
2 SASI_Hs01_00285237 predicted 7987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266787 predicted 8638
2 SASI_Hs01_00266788 predicted 8639
3 SASI_Hs01_00266789 predicted 8933
4 SASI_Hs01_00266790 predicted 8902
5 SASI_Hs01_00266791 predicted 8935
6 SASI_Hs01_00266792 predicted 8933
7 SASI_Hs01_00266793 predicted 8873
8 SASI_Hs01_00266794 predicted 8928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251698 predicted 9578
2 SASI_Hs01_00251699 predicted 9577
3 SASI_Hs01_00251700 predicted 9874
4 SASI_Hs01_00251701 predicted 9838
5 SASI_Hs01_00251702 predicted 9868
6 SASI_Hs01_00251703 predicted 9868
7 SASI_Hs01_00251704 predicted 9805
8 SASI_Hs01_00251705 predicted 9863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287287 predicted 8747
2 SASI_Hs01_00287288 predicted 8744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267067 predicted 8500
2 SASI_Hs01_00267068 predicted 8504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252751 predicted 7590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182905
WASH5P MISSION shRNA Bacterial Glycerol Stock
WAS protein family homolog 5 pseudogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-166s1c1
Sequence:CCGGGCCAACGACCTCATGTACATTCTCGAGAATGTACATGAGGTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-564s1c1
Sequence:CCGGGAAGAAGAAGCAGAAGGAGCACTCGAGTGCTCCTTCTGCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-126s1c1
Sequence:CCGGGATTGATGTTCCATCCTACCTCTCGAGAGGTAGGATGGAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-717s21c1
Sequence:CCGGCTGGCTGGTGCTGTAACAAAGCTCGAGCTTTGTTACAGCACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182905.3-1584s21c1
Sequence:CCGGGTTGCTCTGACATGGACACAGCTCGAGCTGTGTCCATGTCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-550s21c1
Sequence:CCGGAGGAGAAGCTGAAGGACTTTCCTCGAGGAAAGTCCTTCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-278s21c1
Sequence:CCGGAGACATCTTCAGCAGGATCTCCTCGAGGAGATCCTGCTGAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-682s21c1
Sequence:CCGGAGAACCTGTACAAGAAGTATGCTCGAGCATACTTCTTGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182905
WASH5P MISSION shRNA shRNA Plasmid DNA
WAS protein family homolog 5 pseudogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-166s1c1
Sequence:CCGGGCCAACGACCTCATGTACATTCTCGAGAATGTACATGAGGTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-564s1c1
Sequence:CCGGGAAGAAGAAGCAGAAGGAGCACTCGAGTGCTCCTTCTGCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-126s1c1
Sequence:CCGGGATTGATGTTCCATCCTACCTCTCGAGAGGTAGGATGGAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-717s21c1
Sequence:CCGGCTGGCTGGTGCTGTAACAAAGCTCGAGCTTTGTTACAGCACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182905.3-1584s21c1
Sequence:CCGGGTTGCTCTGACATGGACACAGCTCGAGCTGTGTCCATGTCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-550s21c1
Sequence:CCGGAGGAGAAGCTGAAGGACTTTCCTCGAGGAAAGTCCTTCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-278s21c1
Sequence:CCGGAGACATCTTCAGCAGGATCTCCTCGAGGAGATCCTGCTGAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-682s21c1
Sequence:CCGGAGAACCTGTACAAGAAGTATGCTCGAGCATACTTCTTGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182905
WASH5P MISSION shRNA Lentiviral Transduction Particles
WAS protein family homolog 5 pseudogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-166s1c1
Sequence:CCGGGCCAACGACCTCATGTACATTCTCGAGAATGTACATGAGGTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-564s1c1
Sequence:CCGGGAAGAAGAAGCAGAAGGAGCACTCGAGTGCTCCTTCTGCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182905.1-126s1c1
Sequence:CCGGGATTGATGTTCCATCCTACCTCTCGAGAGGTAGGATGGAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-717s21c1
Sequence:CCGGCTGGCTGGTGCTGTAACAAAGCTCGAGCTTTGTTACAGCACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182905.3-1584s21c1
Sequence:CCGGGTTGCTCTGACATGGACACAGCTCGAGCTGTGTCCATGTCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-550s21c1
Sequence:CCGGAGGAGAAGCTGAAGGACTTTCCTCGAGGAAAGTCCTTCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-278s21c1
Sequence:CCGGAGACATCTTCAGCAGGATCTCCTCGAGGAGATCCTGCTGAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182905.3-682s21c1
Sequence:CCGGAGAACCTGTACAAGAAGTATGCTCGAGCATACTTCTTGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks