EMAIL THIS PAGE TO A FRIEND

WASL

Wiskott-Aldrich syndrome-like

Synonyms: N-WASP NWASP
UniProtKB ID: O00401, Q7Z746
Gene ID:
Human(8976) Summary: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension. [provided by RefSeq, Jul 2013]
Mouse(73178) Wiskott-Aldrich syndrome-like (human)
Rat(682507) Wiskott-Aldrich syndrome-like
chicken(417750) Wiskott-Aldrich syndrome-like
domestic cat(101095243) Wiskott-Aldrich syndrome-like
dog(475213) Wiskott-Aldrich syndrome-like
cow(281577) Wiskott-Aldrich syndrome-like
sheep(101106932) Wiskott-Aldrich syndrome-like
domestic guinea pig(100724222) Wiskott-Aldrich syndrome-like
naked mole-rat(101700594) Wiskott-Aldrich syndrome-like
Gene Class: Cytoskeleton
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003941 Rosetta Predictions human pricing
NM_001110365 Rosetta Predictions rat pricing
NM_028459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168242 predicted 408
2 SASI_Hs01_00168243 predicted 647
3 SASI_Hs01_00168244 predicted 1521
4 SASI_Hs01_00168245 predicted 502
5 SASI_Hs01_00168246 predicted 467
6 SASI_Hs01_00168249 predicted 612
7 SASI_Hs01_00168250 predicted 424
8 SASI_Hs01_00168251 predicted 473
9 SASI_Hs02_00336596 predicted 1510
10 SASI_Hs02_00336597 predicted 446
11 SASI_Hs01_00168247 predicted 584
12 SASI_Hs01_00168248 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251192 predicted 632
2 SASI_Rn02_00251193 predicted 623
3 SASI_Rn02_00251194 predicted 615
4 SASI_Rn02_00251195 predicted 2340
5 SASI_Rn02_00251196 predicted 540
6 SASI_Rn02_00251197 predicted 534
7 SASI_Rn02_00251198 predicted 456
8 SASI_Rn02_00251199 predicted 457
9 SASI_Rn02_00251200 predicted 532
10 SASI_Rn02_00251201 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117641 predicted 2223
2 SASI_Mm01_00117642 predicted 2242
3 SASI_Mm01_00117644 predicted 587
4 SASI_Mm01_00117645 predicted 932
5 SASI_Mm01_00117646 predicted 916
6 SASI_Mm01_00117647 predicted 1902
7 SASI_Mm01_00117648 predicted 637
8 SASI_Mm01_00117649 predicted 658
9 SASI_Mm01_00117650 predicted 414
10 SASI_Mm02_00333903 predicted 1629
11 SASI_Mm01_00117643 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003941
VALIDATED
WASL MISSION shRNA Bacterial Glycerol Stock
Wiskott-Aldrich syndrome-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-659s21c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003941.2-2045s21c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1058s21c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1536s21c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-430s21c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-2045s1c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1536s1c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-659s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1058s1c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-430s1c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003941
VALIDATED
WASL MISSION shRNA shRNA Plasmid DNA
Wiskott-Aldrich syndrome-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-659s21c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003941.2-2045s21c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1058s21c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1536s21c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-430s21c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-2045s1c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1536s1c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-659s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1058s1c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-430s1c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003941
VALIDATED
WASL MISSION shRNA Lentiviral Transduction Particles
Wiskott-Aldrich syndrome-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-659s21c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003941.2-2045s21c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1058s21c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-1536s21c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003941.2-430s21c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-2045s1c1
Sequence:CCGGCCTGTTATTGTGTGCAAGTTTCTCGAGAAACTTGCACACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1536s1c1
Sequence:CCGGCAGGAAACAAAGCAGCTCTTTCTCGAGAAAGAGCTGCTTTGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-659s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTTCTCGAGAACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003941.2-1058s1c1
Sequence:CCGGGCACAACTTAAAGACAGAGAACTCGAGTTCTCTGTCTTTAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003941.2-430s1c1
Sequence:CCGGCGGCAAGAAATGTGTGACTATCTCGAGATAGTCACACATTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028459
VALIDATED
WASL MISSION shRNA Bacterial Glycerol Stock
Wiskott-Aldrich syndrome-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028459.1-3006s1c1
Sequence:CCGGGCCTCTTTACAGTACACTAATCTCGAGATTAGTGTACTGTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-1523s1c1
Sequence:CCGGTCAGGAAACAAAGCAGCTCTTCTCGAGAAGAGCTGCTTTGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-908s1c1
Sequence:CCGGAGATTAACCAAGGCAGATATTCTCGAGAATATCTGCCTTGGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-650s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTACTCGAGTACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-512s1c1
Sequence:CCGGGCTTGTCTGGTTAAGGACAATCTCGAGATTGTCCTTAACCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028459
VALIDATED
WASL MISSION shRNA shRNA Plasmid DNA
Wiskott-Aldrich syndrome-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028459.1-3006s1c1
Sequence:CCGGGCCTCTTTACAGTACACTAATCTCGAGATTAGTGTACTGTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-1523s1c1
Sequence:CCGGTCAGGAAACAAAGCAGCTCTTCTCGAGAAGAGCTGCTTTGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-908s1c1
Sequence:CCGGAGATTAACCAAGGCAGATATTCTCGAGAATATCTGCCTTGGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-650s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTACTCGAGTACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-512s1c1
Sequence:CCGGGCTTGTCTGGTTAAGGACAATCTCGAGATTGTCCTTAACCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028459
VALIDATED
WASL MISSION shRNA Lentiviral Transduction Particles
Wiskott-Aldrich syndrome-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028459.1-3006s1c1
Sequence:CCGGGCCTCTTTACAGTACACTAATCTCGAGATTAGTGTACTGTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-1523s1c1
Sequence:CCGGTCAGGAAACAAAGCAGCTCTTCTCGAGAAGAGCTGCTTTGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-908s1c1
Sequence:CCGGAGATTAACCAAGGCAGATATTCTCGAGAATATCTGCCTTGGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-650s1c1
Sequence:CCGGGCTGGAGATACTTGTCAAGTACTCGAGTACTTGACAAGTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028459.1-512s1c1
Sequence:CCGGGCTTGTCTGGTTAAGGACAATCTCGAGATTGTCCTTAACCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks