EMAIL THIS PAGE TO A FRIEND

WBP11

WW domain binding protein 11

Synonyms: NPWBP SIPP1 WBP-11
UniProtKB ID: Q9Y2W2, Q96AY8
Gene ID:
Human(51729) Summary: This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(60321) WW domain binding protein 11
Rat(297695) WW domain binding protein 11
naked mole-rat(101719218) WW domain binding protein 11
domestic guinea pig(100733226) WW domain binding protein 11
cow(534416) WW domain binding protein 11
sheep(101107429) WW domain binding protein 11
Zebrafish(402950) WW domain binding protein 11
chicken(427880) WW domain binding protein 11
dog(609794) WW domain binding protein 11
domestic cat(101095988) WW domain binding protein 11
Horse(100063867) WW domain binding protein 11
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016312 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016312 Rosetta Predictions human pricing
NM_001009661 Rosetta Predictions rat pricing
NM_021714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211291 predicted 1031
2 SASI_Hs01_00211292 predicted 497
3 SASI_Hs01_00211297 predicted 1278
4 SASI_Hs01_00211298 predicted 1058
5 SASI_Hs02_00349245 predicted 986
6 SASI_Hs02_00349246 predicted 515
7 SASI_Hs02_00349247 predicted 449
8 SASI_Hs02_00349248 predicted 428
9 SASI_Hs02_00349249 predicted 856
10 SASI_Hs02_00349250 predicted 1077
11 SASI_Hs01_00211289 predicted 2132
12 SASI_Hs01_00211290 predicted 388
13 SASI_Hs01_00211293 predicted 419
14 SASI_Hs01_00211294 predicted 2143
15 SASI_Hs01_00211295 predicted 483
16 SASI_Hs01_00211296 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113831 predicted 1967
2 SASI_Rn01_00113832 predicted 360
3 SASI_Rn01_00113833 predicted 2011
4 SASI_Rn01_00113834 predicted 1031
5 SASI_Rn01_00113836 predicted 2058
6 SASI_Rn01_00113838 predicted 312
7 SASI_Rn02_00199692 predicted 1970
8 SASI_Rn01_00113840 predicted 348
9 SASI_Rn02_00199693 predicted 602
10 SASI_Rn02_00199694 predicted 989
11 SASI_Rn01_00113835 predicted 1033
12 SASI_Rn01_00113837 predicted 433
13 SASI_Rn01_00113839 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070234 predicted 2130
2 SASI_Mm02_00326401 predicted 1988
3 SASI_Mm01_00070236 predicted 2125
4 SASI_Mm01_00070237 predicted 2133
5 SASI_Mm02_00326402 predicted 2032
6 SASI_Mm02_00326403 predicted 2023
7 SASI_Mm02_00326404 predicted 540
8 SASI_Mm01_00070238 predicted 2096
9 SASI_Mm01_00070239 predicted 1680
10 SASI_Mm02_00326405 predicted 547
11 SASI_Mm01_00070233 predicted 454
12 SASI_Mm01_00070235 predicted 388
13 SASI_Mm01_00070240 predicted 2114
14 SASI_Mm01_00070241 predicted 852
15 SASI_Mm01_00070242 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021714
VALIDATED
WBP11 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021714.3-2344s21c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-2048s21c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-410s21c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-1063s1c1
Sequence:CCGGGTCAGGTCTAAGCGTCAGATTCTCGAGAATCTGACGCTTAGACCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-410s1c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021714.3-304s1c1
Sequence:CCGGCAAACAAATTATCCGGGACATCTCGAGATGTCCCGGATAATTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2344s1c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2048s1c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021714
VALIDATED
WBP11 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021714.3-2344s21c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-2048s21c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-410s21c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-1063s1c1
Sequence:CCGGGTCAGGTCTAAGCGTCAGATTCTCGAGAATCTGACGCTTAGACCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-410s1c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021714.3-304s1c1
Sequence:CCGGCAAACAAATTATCCGGGACATCTCGAGATGTCCCGGATAATTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2344s1c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2048s1c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021714
VALIDATED
WBP11 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021714.3-2344s21c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-2048s21c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021714.3-410s21c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-1063s1c1
Sequence:CCGGGTCAGGTCTAAGCGTCAGATTCTCGAGAATCTGACGCTTAGACCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-410s1c1
Sequence:CCGGCGGGAAACCTTTGAACGCATTCTCGAGAATGCGTTCAAAGGTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021714.3-304s1c1
Sequence:CCGGCAAACAAATTATCCGGGACATCTCGAGATGTCCCGGATAATTTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2344s1c1
Sequence:CCGGGCGAGGTCTTAGTTACTTGTTCTCGAGAACAAGTAACTAAGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021714.3-2048s1c1
Sequence:CCGGGCCTTTATGAAAGAGATGGAACTCGAGTTCCATCTCTTTCATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016312
VALIDATED
WBP11 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-976s21c1
Sequence:CCGGATGACAGTGACACCGACAAATCTCGAGATTTGTCGGTGTCACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-647s21c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016312.2-2172s21c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1856s21c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1019s21c1
Sequence:CCGGTGAATTTGTGCACCGTGATAACTCGAGTTATCACGGTGCACAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-647s1c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-648s1c1
Sequence:CCGGCCACCCTCTATCCTAAAGAAACTCGAGTTTCTTTAGGATAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-1856s1c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-540s1c1
Sequence:CCGGGCTGTCAAGAATGCTCAGCATCTCGAGATGCTGAGCATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016312.2-2172s1c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016312
VALIDATED
WBP11 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-976s21c1
Sequence:CCGGATGACAGTGACACCGACAAATCTCGAGATTTGTCGGTGTCACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-647s21c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016312.2-2172s21c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1856s21c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1019s21c1
Sequence:CCGGTGAATTTGTGCACCGTGATAACTCGAGTTATCACGGTGCACAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-647s1c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-648s1c1
Sequence:CCGGCCACCCTCTATCCTAAAGAAACTCGAGTTTCTTTAGGATAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-1856s1c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-540s1c1
Sequence:CCGGGCTGTCAAGAATGCTCAGCATCTCGAGATGCTGAGCATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016312.2-2172s1c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016312
VALIDATED
WBP11 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-976s21c1
Sequence:CCGGATGACAGTGACACCGACAAATCTCGAGATTTGTCGGTGTCACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-647s21c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016312.2-2172s21c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1856s21c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016312.2-1019s21c1
Sequence:CCGGTGAATTTGTGCACCGTGATAACTCGAGTTATCACGGTGCACAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-647s1c1
Sequence:CCGGGCCACCCTCTATCCTAAAGAACTCGAGTTCTTTAGGATAGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-648s1c1
Sequence:CCGGCCACCCTCTATCCTAAAGAAACTCGAGTTTCTTTAGGATAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-1856s1c1
Sequence:CCGGGCCACAGATCACTAATCCCAACTCGAGTTGGGATTAGTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016312.2-540s1c1
Sequence:CCGGGCTGTCAAGAATGCTCAGCATCTCGAGATGCTGAGCATTCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016312.2-2172s1c1
Sequence:CCGGGCTTCCATTGTCAGGGTATTTCTCGAGAAATACCCTGACAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks