EMAIL THIS PAGE TO A FRIEND

WBP1

WW domain binding protein 1

Synonyms: WBP-1
UniProtKB ID: Q96G27, B2RE02, O95637
Gene ID:
Human(23559) Summary: The globular WW domain, named for the conserved tryptophan residues in the protein motif present in various structural and regulatory proteins, is known to play a role in the mediation of protein-protein interactions. This gene encodes a ligand of the WW domain of the Yes kinase-associated protein. Readthrough transcription of the neighboring upstream gene, which encodes INO80 complex subunit B, into this gene generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Mouse(22377) WW domain binding protein 1
Rat(297381) WW domain binding protein 1
domestic cat(101085968) WW domain binding protein 1
dog(475787) WW domain binding protein 1
cow(509188) WW domain binding protein 1
sheep(101117742) WW domain binding protein 1
domestic guinea pig(100712643) WW domain binding protein 1
naked mole-rat(101700019) WW domain binding protein 1
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012477 Rosetta Predictions human pricing
NM_001106600 Rosetta Predictions rat pricing
NM_001083922 Rosetta Predictions mouse pricing
NM_001083923 Rosetta Predictions mouse pricing
NM_016757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228845 predicted 895
2 SASI_Hs01_00228846 predicted 219
3 SASI_Hs01_00228848 predicted 901
4 SASI_Hs01_00228850 predicted 283
5 SASI_Hs01_00228852 predicted 829
6 SASI_Hs01_00228853 predicted 901
7 SASI_Hs01_00228854 predicted 828
8 SASI_Hs02_00344389 predicted 251
9 SASI_Hs02_00344390 predicted 206
10 SASI_Hs01_00228849 predicted 254
11 SASI_Hs01_00228847 predicted 296
12 SASI_Hs01_00228851 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220548 predicted 788
2 SASI_Rn02_00220549 predicted 382
3 SASI_Rn02_00220550 predicted 409
4 SASI_Rn02_00220551 predicted 424
5 SASI_Rn02_00220552 predicted 588
6 SASI_Rn02_00220553 predicted 941
7 SASI_Rn02_00220554 predicted 468
8 SASI_Rn02_00220555 predicted 378
9 SASI_Rn02_00220556 predicted 773
10 SASI_Rn02_00220557 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300016 predicted 729
2 SASI_Mm02_00300017 predicted 556
3 SASI_Mm02_00300018 predicted 667
4 SASI_Mm02_00300019 predicted 904
5 SASI_Mm02_00300020 predicted 725
6 SASI_Mm02_00300021 predicted 618
7 SASI_Mm02_00300022 predicted 914
8 SASI_Mm02_00300023 predicted 911
9 SASI_Mm02_00300024 predicted 895
10 SASI_Mm02_00300025 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300026 predicted 625
2 SASI_Mm02_00300027 predicted 458
3 SASI_Mm02_00300028 predicted 557
4 SASI_Mm02_00300029 predicted 804
5 SASI_Mm02_00300030 predicted 626
6 SASI_Mm02_00300031 predicted 510
7 SASI_Mm02_00300032 predicted 813
8 SASI_Mm02_00300033 predicted 810
9 SASI_Mm02_00300034 predicted 798
10 SASI_Mm02_00300035 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323497 predicted 731
2 SASI_Mm01_00070425 predicted 564
3 SASI_Mm01_00070426 predicted 667
4 SASI_Mm01_00070430 predicted 909
5 SASI_Mm02_00323498 predicted 729
6 SASI_Mm02_00323499 predicted 616
7 SASI_Mm02_00323500 predicted 916
8 SASI_Mm02_00323501 predicted 916
9 SASI_Mm02_00323502 predicted 898
10 SASI_Mm02_00323503 predicted 909
11 SASI_Mm01_00070423 predicted 357
12 SASI_Mm01_00070424 predicted 896
13 SASI_Mm01_00070427 predicted 343
14 SASI_Mm01_00070428 predicted 456
15 SASI_Mm01_00070429 predicted 450
16 SASI_Mm01_00070431 predicted 394
17 SASI_Mm01_00070432 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016757
VALIDATED
WBP1 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-879s1c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-524s1c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-699s1c1
Sequence:CCGGCCTTGGACTACTTCCAGTGAACTCGAGTTCACTGGAAGTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-253s1c1
Sequence:CCGGCAATTTGGAGACGAGCTGGAACTCGAGTTCCAGCTCGTCTCCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016757.1-1074s1c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-483s21c1
Sequence:CCGGGGACTGTCCTCATCCTCTTTACTCGAGTAAAGAGGATGAGGACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-372s21c1
Sequence:CCGGAGCTGTGCCCAGGAGTGAATACTCGAGTATTCACTCCTGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-917s21c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-562s21c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-1113s21c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016757
VALIDATED
WBP1 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-879s1c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-524s1c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-699s1c1
Sequence:CCGGCCTTGGACTACTTCCAGTGAACTCGAGTTCACTGGAAGTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-253s1c1
Sequence:CCGGCAATTTGGAGACGAGCTGGAACTCGAGTTCCAGCTCGTCTCCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016757.1-1074s1c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-483s21c1
Sequence:CCGGGGACTGTCCTCATCCTCTTTACTCGAGTAAAGAGGATGAGGACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-372s21c1
Sequence:CCGGAGCTGTGCCCAGGAGTGAATACTCGAGTATTCACTCCTGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-917s21c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-562s21c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-1113s21c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016757
VALIDATED
WBP1 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-879s1c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-524s1c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-699s1c1
Sequence:CCGGCCTTGGACTACTTCCAGTGAACTCGAGTTCACTGGAAGTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016757.1-253s1c1
Sequence:CCGGCAATTTGGAGACGAGCTGGAACTCGAGTTCCAGCTCGTCTCCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016757.1-1074s1c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-483s21c1
Sequence:CCGGGGACTGTCCTCATCCTCTTTACTCGAGTAAAGAGGATGAGGACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-372s21c1
Sequence:CCGGAGCTGTGCCCAGGAGTGAATACTCGAGTATTCACTCCTGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-917s21c1
Sequence:CCGGCTAACTGGTGACTCGGGTATTCTCGAGAATACCCGAGTCACCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-562s21c1
Sequence:CCGGGCAGCGTGAAATCAACTTGTTCTCGAGAACAAGTTGATTTCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016757.2-1113s21c1
Sequence:CCGGCAAGAGGGAAACTGGGTATTACTCGAGTAATACCCAGTTTCCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012477
WBP1 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-665s1c1
Sequence:CCGGCAAATGTGGAAGGTGTTTCCTCTCGAGAGGAAACACCTTCCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-658s1c1
Sequence:CCGGGAAGGAACAAATGTGGAAGGTCTCGAGACCTTCCACATTTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-427s1c1
Sequence:CCGGGAAATCAACTTGTTGGCCTATCTCGAGATAGGCCAACAAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-654s1c1
Sequence:CCGGCTTTGAAGGAACAAATGTGGACTCGAGTCCACATTTGTTCCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-300s1c1
Sequence:CCGGCTGCACCTACTACTATGAGCTCTCGAGAGCTCATAGTAGTAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-904s1c1
Sequence:CCGGGAGTCTGTACCGCAGATCTTTCTCGAGAAAGATCTGCGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-391s1c1
Sequence:CCGGGCTAAACTCAGGCTGCAACAACTCGAGTTGTTGCAGCCTGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-309s1c1
Sequence:CCGGCTACTATGAGCTCTGGTGGTTCTCGAGAACCACCAGAGCTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012477.2-985s21c1
Sequence:CCGGGGTTACTTGCCCACCAGAAACCTCGAGGTTTCTGGTGGGCAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012477.2-600s21c1
Sequence:CCGGGACTGCTTCCAGTGAACAAACCTCGAGGTTTGTTCACTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012477
WBP1 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-665s1c1
Sequence:CCGGCAAATGTGGAAGGTGTTTCCTCTCGAGAGGAAACACCTTCCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-658s1c1
Sequence:CCGGGAAGGAACAAATGTGGAAGGTCTCGAGACCTTCCACATTTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-427s1c1
Sequence:CCGGGAAATCAACTTGTTGGCCTATCTCGAGATAGGCCAACAAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-654s1c1
Sequence:CCGGCTTTGAAGGAACAAATGTGGACTCGAGTCCACATTTGTTCCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-300s1c1
Sequence:CCGGCTGCACCTACTACTATGAGCTCTCGAGAGCTCATAGTAGTAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-904s1c1
Sequence:CCGGGAGTCTGTACCGCAGATCTTTCTCGAGAAAGATCTGCGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-391s1c1
Sequence:CCGGGCTAAACTCAGGCTGCAACAACTCGAGTTGTTGCAGCCTGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-309s1c1
Sequence:CCGGCTACTATGAGCTCTGGTGGTTCTCGAGAACCACCAGAGCTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012477.2-985s21c1
Sequence:CCGGGGTTACTTGCCCACCAGAAACCTCGAGGTTTCTGGTGGGCAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012477.2-600s21c1
Sequence:CCGGGACTGCTTCCAGTGAACAAACCTCGAGGTTTGTTCACTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012477
WBP1 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-665s1c1
Sequence:CCGGCAAATGTGGAAGGTGTTTCCTCTCGAGAGGAAACACCTTCCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-658s1c1
Sequence:CCGGGAAGGAACAAATGTGGAAGGTCTCGAGACCTTCCACATTTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-427s1c1
Sequence:CCGGGAAATCAACTTGTTGGCCTATCTCGAGATAGGCCAACAAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-654s1c1
Sequence:CCGGCTTTGAAGGAACAAATGTGGACTCGAGTCCACATTTGTTCCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-300s1c1
Sequence:CCGGCTGCACCTACTACTATGAGCTCTCGAGAGCTCATAGTAGTAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-904s1c1
Sequence:CCGGGAGTCTGTACCGCAGATCTTTCTCGAGAAAGATCTGCGGTACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012477.2-391s1c1
Sequence:CCGGGCTAAACTCAGGCTGCAACAACTCGAGTTGTTGCAGCCTGAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012477.2-309s1c1
Sequence:CCGGCTACTATGAGCTCTGGTGGTTCTCGAGAACCACCAGAGCTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012477.2-985s21c1
Sequence:CCGGGGTTACTTGCCCACCAGAAACCTCGAGGTTTCTGGTGGGCAAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012477.2-600s21c1
Sequence:CCGGGACTGCTTCCAGTGAACAAACCTCGAGGTTTGTTCACTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks