EMAIL THIS PAGE TO A FRIEND

WBP1L

WW domain binding protein 1-like

Synonyms: C10orf26 OPA1L OPAL1
Gene ID:
Mouse(226178) WW domain binding protein 1 like
Rat(309456) WW domain binding protein 1-like
dog(608567) WW domain binding protein 1-like
domestic cat(101082851) WW domain binding protein 1-like
cow(540056) WW domain binding protein 1-like
sheep(101109314) WW domain binding protein 1-like
domestic guinea pig(100723115) WW domain binding protein 1-like
naked mole-rat(101696968) WW domain binding protein 1-like
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083913 Rosetta Predictions human pricing
NM_017787 Rosetta Predictions human pricing
NM_001127484 Rosetta Predictions rat pricing
NM_146099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317291 predicted 461
2 SASI_Hs02_00317292 predicted 1232
3 SASI_Hs02_00317293 predicted 1371
4 SASI_Hs02_00317294 predicted 1519
5 SASI_Hs02_00317295 predicted 869
6 SASI_Hs02_00317296 predicted 1388
7 SASI_Hs02_00317297 predicted 1421
8 SASI_Hs02_00317298 predicted 962
9 SASI_Hs02_00317299 predicted 812
10 SASI_Hs02_00317300 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043390 predicted 571
2 SASI_Hs01_00043391 predicted 1354
3 SASI_Hs01_00043392 predicted 1490
4 SASI_Hs01_00043393 predicted 1635
5 SASI_Hs01_00043394 predicted 979
6 SASI_Hs01_00043396 predicted 1502
7 SASI_Hs01_00043397 predicted 1537
8 SASI_Hs01_00043398 predicted 1071
9 SASI_Hs01_00043399 predicted 922
10 SASI_Hs02_00350653 predicted 1515
11 SASI_Hs01_00043395 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253843 predicted 816
2 SASI_Rn02_00253844 predicted 1638
3 SASI_Rn02_00253845 predicted 1332
4 SASI_Rn02_00253846 predicted 1516
5 SASI_Rn02_00253847 predicted 805
6 SASI_Rn02_00253848 predicted 1535
7 SASI_Rn02_00253849 predicted 681
8 SASI_Rn02_00253850 predicted 729
9 SASI_Rn02_00253851 predicted 954
10 SASI_Rn02_00253852 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165348 predicted 1255
2 SASI_Mm01_00165349 predicted 1295
3 SASI_Mm01_00165350 predicted 1243
4 SASI_Mm01_00165351 predicted 1175
5 SASI_Mm01_00165352 predicted 1218
6 SASI_Mm01_00165353 predicted 1530
7 SASI_Mm01_00165354 predicted 916
8 SASI_Mm01_00165355 predicted 1171
9 SASI_Mm01_00165356 predicted 374
10 SASI_Mm01_00165357 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017787
VALIDATED
WBP1L MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 1-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017787.3-364s1c1
Sequence:CCGGGCGGCAACATGAAATCAACCTCTCGAGAGGTTGATTTCATGTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-944s1c1
Sequence:CCGGGAGTTCAACACACTCATCGATCTCGAGATCGATGAGTGTGTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-2666s1c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-183s1c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-931s1c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-1724s1c1
Sequence:CCGGCCGTTGTATGATAGGTTGGTACTCGAGTACCAACCTATCATACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017787.3-2026s1c1
Sequence:CCGGCCAGAAGATGTCTCGTGTGAACTCGAGTTCACACGAGACATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-956s1c1
Sequence:CCGGCTCATCGATGATGCTCTGGATCTCGAGATCCAGAGCATCATCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-565s21c1
Sequence:CCGGACTATTTACTACCTCCTTATGCTCGAGCATAAGGAGGTAGTAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-301s21c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-2784s21c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-509s21c1
Sequence:CCGGTTACCGAGAAGCCCACAATTACTCGAGTAATTGTGGGCTTCTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-1049s21c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017787
VALIDATED
WBP1L MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 1-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017787.3-364s1c1
Sequence:CCGGGCGGCAACATGAAATCAACCTCTCGAGAGGTTGATTTCATGTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-944s1c1
Sequence:CCGGGAGTTCAACACACTCATCGATCTCGAGATCGATGAGTGTGTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-2666s1c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-183s1c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-931s1c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-1724s1c1
Sequence:CCGGCCGTTGTATGATAGGTTGGTACTCGAGTACCAACCTATCATACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017787.3-2026s1c1
Sequence:CCGGCCAGAAGATGTCTCGTGTGAACTCGAGTTCACACGAGACATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-956s1c1
Sequence:CCGGCTCATCGATGATGCTCTGGATCTCGAGATCCAGAGCATCATCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-565s21c1
Sequence:CCGGACTATTTACTACCTCCTTATGCTCGAGCATAAGGAGGTAGTAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-301s21c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-2784s21c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-509s21c1
Sequence:CCGGTTACCGAGAAGCCCACAATTACTCGAGTAATTGTGGGCTTCTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-1049s21c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017787
VALIDATED
WBP1L MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 1-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017787.3-364s1c1
Sequence:CCGGGCGGCAACATGAAATCAACCTCTCGAGAGGTTGATTTCATGTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-944s1c1
Sequence:CCGGGAGTTCAACACACTCATCGATCTCGAGATCGATGAGTGTGTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-2666s1c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-183s1c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-931s1c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017787.3-1724s1c1
Sequence:CCGGCCGTTGTATGATAGGTTGGTACTCGAGTACCAACCTATCATACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017787.3-2026s1c1
Sequence:CCGGCCAGAAGATGTCTCGTGTGAACTCGAGTTCACACGAGACATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017787.3-956s1c1
Sequence:CCGGCTCATCGATGATGCTCTGGATCTCGAGATCCAGAGCATCATCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-565s21c1
Sequence:CCGGACTATTTACTACCTCCTTATGCTCGAGCATAAGGAGGTAGTAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-301s21c1
Sequence:CCGGGTGTGGGTACCAACAATCAAACTCGAGTTTGATTGTTGGTACCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-2784s21c1
Sequence:CCGGCGATGATGATATTCAGACGAACTCGAGTTCGTCTGAATATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-509s21c1
Sequence:CCGGTTACCGAGAAGCCCACAATTACTCGAGTAATTGTGGGCTTCTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017787.4-1049s21c1
Sequence:CCGGCGATGACCTCAAAGAGTTCAACTCGAGTTGAACTCTTTGAGGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146099
VALIDATED
WBP1L MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 1-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-963s1c1
Sequence:CCGGCAAAGAGTTTAACACGCTCATCTCGAGATGAGCGTGTTAAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-1284s1c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146099.1-1247s1c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-960s1c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1216s21c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1253s21c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1117s21c1
Sequence:CCGGATGAGCAGGACTCTCCAAATTCTCGAGAATTTGGAGAGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-929s21c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146099.2-259s21c1
Sequence:CCGGTGTGGACCGTCGTCATCATTCCTCGAGGAATGATGACGACGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146099
VALIDATED
WBP1L MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 1-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-963s1c1
Sequence:CCGGCAAAGAGTTTAACACGCTCATCTCGAGATGAGCGTGTTAAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-1284s1c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146099.1-1247s1c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-960s1c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1216s21c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1253s21c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1117s21c1
Sequence:CCGGATGAGCAGGACTCTCCAAATTCTCGAGAATTTGGAGAGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-929s21c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146099.2-259s21c1
Sequence:CCGGTGTGGACCGTCGTCATCATTCCTCGAGGAATGATGACGACGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146099
VALIDATED
WBP1L MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 1-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-963s1c1
Sequence:CCGGCAAAGAGTTTAACACGCTCATCTCGAGATGAGCGTGTTAAACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-1284s1c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146099.1-1247s1c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146099.1-960s1c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1216s21c1
Sequence:CCGGCCACGAGAGAAGCATTAAGTACTCGAGTACTTAATGCTTCTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1253s21c1
Sequence:CCGGCGGCCACTTTGTCCTCTTATACTCGAGTATAAGAGGACAAAGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-1117s21c1
Sequence:CCGGATGAGCAGGACTCTCCAAATTCTCGAGAATTTGGAGAGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146099.2-929s21c1
Sequence:CCGGCCTCAAAGAGTTTAACACGCTCTCGAGAGCGTGTTAAACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146099.2-259s21c1
Sequence:CCGGTGTGGACCGTCGTCATCATTCCTCGAGGAATGATGACGACGGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks